Incidental Mutation 'R5037:Mthfd1'
ID478076
Institutional Source Beutler Lab
Gene Symbol Mthfd1
Ensembl Gene ENSMUSG00000021048
Gene Namemethylenetetrahydrofolate dehydrogenase (NADP+ dependent), methenyltetrahydrofolate cyclohydrolase, formyltetrahydrofolate synthase
SynonymsMthfd, DCS, E430024A07Rik
Accession Numbers

Genbank: NM_138745; MGI: 1342005

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5037 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location76255298-76319803 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 76294140 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Valine at position 258 (F258V)
Ref Sequence ENSEMBL: ENSMUSP00000151500 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021443] [ENSMUST00000220046]
Predicted Effect possibly damaging
Transcript: ENSMUST00000021443
AA Change: F438V

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000021443
Gene: ENSMUSG00000021048
AA Change: F438V

DomainStartEndE-ValueType
Pfam:THF_DHG_CYH 6 125 1.7e-36 PFAM
Pfam:THF_DHG_CYH_C 128 295 1.1e-67 PFAM
Pfam:FTHFS 317 935 4.1e-259 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218010
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218331
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218341
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218513
Predicted Effect probably damaging
Transcript: ENSMUST00000220046
AA Change: F258V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a trifunctional cytoplasmic enzyme. The encoded protein functions as a methylenetetrahydrofolate dehydrogenase, a methenyltetrahydrofolate cyclohydrolase, and a formyltetrahydrofolate synthase. The encoded enzyme functions in de novo synthesis of purines and thymidylate and in regeneration of methionine from homocysteine. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit embryonic lethality. Mice heterozygous for a gene trap allele exhibit altered amino acid levels and nucleotide metabolism related to dietary folate and choline concentrations. [provided by MGI curators]
Allele List at MGI

All alleles(57) : Targeted, other(2) Gene trapped(54) Radiation induced(1)

Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik T A 4: 42,972,195 H509Q probably benign Het
6430531B16Rik A T 7: 139,978,674 S3R possibly damaging Het
Btaf1 T C 19: 37,003,531 V1584A probably damaging Het
Ccdc136 A T 6: 29,417,123 S648C probably damaging Het
Ccna2 A G 3: 36,571,003 probably benign Het
Cdc23 C A 18: 34,651,689 V7L unknown Het
Cenpf T C 1: 189,683,846 E94G probably damaging Het
Clic1 G A 17: 35,055,259 V139I probably benign Het
Coasy A G 11: 101,084,822 E327G probably damaging Het
Col6a5 C T 9: 105,928,138 E1190K unknown Het
Cyp2c70 A G 19: 40,183,997 V67A possibly damaging Het
Dglucy A G 12: 100,835,241 S52G probably benign Het
Dync1h1 A G 12: 110,640,907 N2644S probably benign Het
Eif4g2 A T 7: 111,077,032 N347K probably benign Het
Epha10 T C 4: 124,915,385 probably benign Het
Epm2aip1 T C 9: 111,272,150 F64L probably benign Het
Eri2 G A 7: 119,785,674 L535F probably benign Het
Fam71e2 T G 7: 4,758,576 K379T possibly damaging Het
Gm17430 T C 18: 9,726,561 E37G probably benign Het
Heatr5b T A 17: 78,824,510 Q388L probably benign Het
Htr1f A G 16: 64,925,928 W334R probably damaging Het
Icam4 A T 9: 21,029,641 C717* probably null Het
Iqgap1 A C 7: 80,734,100 L1072W probably damaging Het
Kbtbd11 G T 8: 15,027,886 A162S probably benign Het
Kif13b T G 14: 64,758,589 Y941* probably null Het
Kndc1 T C 7: 139,910,455 V291A possibly damaging Het
Lrrn3 A T 12: 41,453,595 I241N probably damaging Het
Macf1 A G 4: 123,455,519 S2387P probably damaging Het
Msh5 A G 17: 35,032,393 L451S possibly damaging Het
Ncstn C T 1: 172,068,626 R495H probably damaging Het
Olfr730 T G 14: 50,186,288 T310P probably benign Het
Pkd1l3 T A 8: 109,665,636 I1954N probably damaging Het
Ppox C A 1: 171,277,596 V340L probably damaging Het
Prkag1 T C 15: 98,815,887 T21A possibly damaging Het
Pygo1 C A 9: 72,944,917 H129N probably damaging Het
Rad9a A T 19: 4,197,174 C271S probably benign Het
Raph1 T C 1: 60,496,222 probably null Het
Reln A G 5: 21,948,512 F2265L probably damaging Het
Shc4 A G 2: 125,629,727 I304T probably damaging Het
Slc35f3 T A 8: 126,389,272 L313M probably damaging Het
Sycp2l T A 13: 41,129,861 M191K possibly damaging Het
Tmem132c C A 5: 127,553,135 Q579K probably benign Het
Trbj2-5 A G 6: 41,543,460 probably benign Het
Ttc38 A G 15: 85,844,540 E231G probably benign Het
Utp20 A G 10: 88,775,330 V1375A probably benign Het
Vcan T A 13: 89,703,977 T955S probably damaging Het
Vmn1r89 T C 7: 13,219,387 C17R possibly damaging Het
Wnk1 A G 6: 119,965,735 probably benign Het
Zfp667 T G 7: 6,305,950 I539S possibly damaging Het
Zfp738 T A 13: 67,670,201 H557L probably damaging Het
Other mutations in Mthfd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00591:Mthfd1 APN 12 76300439 missense possibly damaging 0.79
IGL01996:Mthfd1 APN 12 76303905 missense probably damaging 1.00
IGL02399:Mthfd1 APN 12 76317632 missense probably damaging 1.00
IGL02529:Mthfd1 APN 12 76303709 missense probably benign 0.02
3-1:Mthfd1 UTSW 12 76314400 critical splice acceptor site probably null
R0062:Mthfd1 UTSW 12 76297589 splice site probably benign
R0062:Mthfd1 UTSW 12 76297589 splice site probably benign
R0732:Mthfd1 UTSW 12 76294174 missense probably damaging 1.00
R1572:Mthfd1 UTSW 12 76270419 nonsense probably null
R1918:Mthfd1 UTSW 12 76314976 missense probably damaging 1.00
R2008:Mthfd1 UTSW 12 76297519 missense probably damaging 1.00
R2280:Mthfd1 UTSW 12 76280492 missense probably benign 0.37
R2857:Mthfd1 UTSW 12 76288925 missense probably damaging 0.99
R2859:Mthfd1 UTSW 12 76288925 missense probably damaging 0.99
R2997:Mthfd1 UTSW 12 76315036 missense probably benign 0.01
R3034:Mthfd1 UTSW 12 76289470 missense probably benign 0.04
R3153:Mthfd1 UTSW 12 76311963 missense probably benign
R3412:Mthfd1 UTSW 12 76303749 splice site probably null
R4135:Mthfd1 UTSW 12 76282874 splice site probably null
R4245:Mthfd1 UTSW 12 76301273 missense probably damaging 0.99
R4498:Mthfd1 UTSW 12 76314990 missense probably damaging 1.00
R4573:Mthfd1 UTSW 12 76294138 critical splice acceptor site probably null
R5022:Mthfd1 UTSW 12 76294374 missense probably damaging 1.00
R5022:Mthfd1 UTSW 12 76301328 missense probably damaging 1.00
R5455:Mthfd1 UTSW 12 76301288 missense probably benign 0.20
R5879:Mthfd1 UTSW 12 76294218 missense probably benign 0.00
R5902:Mthfd1 UTSW 12 76291052 missense probably benign 0.01
R6119:Mthfd1 UTSW 12 76303673 missense probably damaging 1.00
R6199:Mthfd1 UTSW 12 76288911 missense probably damaging 1.00
R6199:Mthfd1 UTSW 12 76303680 missense probably damaging 1.00
R6931:Mthfd1 UTSW 12 76303698 missense probably benign
R7405:Mthfd1 UTSW 12 76311874 missense probably damaging 0.98
R7658:Mthfd1 UTSW 12 76270435 missense probably damaging 1.00
R8053:Mthfd1 UTSW 12 76280508 missense probably damaging 1.00
X0012:Mthfd1 UTSW 12 76314408 missense possibly damaging 0.75
Z1176:Mthfd1 UTSW 12 76303967 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- GGAGTTGTTTCAAAGGCCAG -3'
(R):5'- TACTGTCATGGCACCAAAAGAC -3'

Sequencing Primer
(F):5'- TAGATCAGTCTGGCCTCGAACTG -3'
(R):5'- GACCAATACTAATTCAGGTACCCC -3'
Posted On2017-05-23