Incidental Mutation 'R5025:Psg20'
ID478093
Institutional Source Beutler Lab
Gene Symbol Psg20
Ensembl Gene ENSMUSG00000063305
Gene Namepregnancy-specific glycoprotein 20
Synonymscea7, EG434540
MMRRC Submission 042616-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R5025 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location18674107-18686185 bp(-) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) T to C at 18674366 bp
ZygosityHeterozygous
Amino Acid Change Stop codon to Tryptophan at position 473 (*473W)
Ref Sequence ENSEMBL: ENSMUSP00000104122 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076677] [ENSMUST00000108482]
Predicted Effect probably null
Transcript: ENSMUST00000076677
AA Change: *476W
SMART Domains Protein: ENSMUSP00000075973
Gene: ENSMUSG00000063305
AA Change: *476W

DomainStartEndE-ValueType
IG 40 141 2.34e-4 SMART
IG 160 261 2.14e0 SMART
IG 280 381 8.01e-3 SMART
IGc2 397 461 1.47e-10 SMART
Predicted Effect probably null
Transcript: ENSMUST00000108482
AA Change: *473W
SMART Domains Protein: ENSMUSP00000104122
Gene: ENSMUSG00000063305
AA Change: *473W

DomainStartEndE-ValueType
IG 40 141 2.34e-4 SMART
IG 160 261 2.14e0 SMART
IG 277 378 8.01e-3 SMART
IGc2 394 458 1.47e-10 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 100% (40/40)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm2 T A 7: 119,554,496 F10I unknown Het
Adad1 G T 3: 37,065,210 A147S probably damaging Het
Atg14 T G 14: 47,545,816 N354T probably damaging Het
Brip1 T A 11: 86,064,980 E902D probably benign Het
Brwd1 A G 16: 96,053,972 S419P probably damaging Het
Camsap3 A G 8: 3,604,244 K638R probably damaging Het
Dennd4c T A 4: 86,795,299 probably null Het
Dnah3 T C 7: 120,071,905 N585S probably benign Het
Eef1akmt2 C A 7: 132,851,489 W38L probably damaging Het
Fasn A T 11: 120,811,908 D1709E probably benign Het
Fbrsl1 T C 5: 110,417,901 D179G probably damaging Het
Fbxl18 A T 5: 142,886,313 I389N probably damaging Het
Fuca1 G T 4: 135,932,926 G252C probably damaging Het
Fut9 T A 4: 25,620,502 H104L probably damaging Het
Glra1 C T 11: 55,536,505 probably null Het
Gpsm1 T C 2: 26,319,996 V45A possibly damaging Het
Hadha A G 5: 30,154,961 probably benign Het
Hddc2 C T 10: 31,327,953 T192I probably benign Het
Herc1 A T 9: 66,470,326 K3458M possibly damaging Het
Igkv14-100 A G 6: 68,519,399 D92G probably damaging Het
Il17rc T C 6: 113,472,366 V88A possibly damaging Het
Inpp5j T C 11: 3,500,664 D563G probably damaging Het
Lamc3 T A 2: 31,908,669 N462K probably benign Het
Mrpl15 T C 1: 4,784,145 probably benign Het
Myh7b G C 2: 155,632,373 R1669S possibly damaging Het
Olfr135 T C 17: 38,208,443 L66P probably damaging Het
Olfr1484 G T 19: 13,585,522 A30S probably benign Het
Rimbp3 A G 16: 17,209,807 E365G probably damaging Het
Rnf219 C T 14: 104,508,030 G70E probably damaging Het
Snai2 A G 16: 14,708,189 T235A possibly damaging Het
Tg A T 15: 66,707,930 Y1528F probably damaging Het
Tlr3 A G 8: 45,403,038 V35A probably benign Het
Tnfsf15 T C 4: 63,729,888 I172V probably benign Het
Tns1 G A 1: 73,925,482 T1330I probably damaging Het
Zc3h6 T A 2: 129,010,433 F330I possibly damaging Het
Zdbf2 A G 1: 63,303,650 E396G possibly damaging Het
Other mutations in Psg20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00492:Psg20 APN 7 18674611 missense possibly damaging 0.72
IGL01459:Psg20 APN 7 18682713 missense probably damaging 1.00
IGL01599:Psg20 APN 7 18681038 missense possibly damaging 0.83
IGL01678:Psg20 APN 7 18680870 missense probably damaging 1.00
IGL01991:Psg20 APN 7 18684425 missense probably benign 0.01
IGL02449:Psg20 APN 7 18684408 splice site probably benign
IGL02522:Psg20 APN 7 18682431 missense probably benign 0.06
IGL03358:Psg20 APN 7 18680966 missense probably benign 0.04
PIT4431001:Psg20 UTSW 7 18674550 missense probably damaging 1.00
R0136:Psg20 UTSW 7 18682507 missense probably damaging 0.98
R0184:Psg20 UTSW 7 18685976 missense probably null 0.95
R0894:Psg20 UTSW 7 18681044 nonsense probably null
R1291:Psg20 UTSW 7 18684674 missense possibly damaging 0.46
R1997:Psg20 UTSW 7 18682610 missense probably benign 0.00
R2118:Psg20 UTSW 7 18681022 missense probably benign 0.19
R2119:Psg20 UTSW 7 18681022 missense probably benign 0.19
R2120:Psg20 UTSW 7 18681022 missense probably benign 0.19
R2121:Psg20 UTSW 7 18681022 missense probably benign 0.19
R2124:Psg20 UTSW 7 18681022 missense probably benign 0.19
R2127:Psg20 UTSW 7 18682718 missense probably damaging 0.99
R3795:Psg20 UTSW 7 18684449 missense probably benign 0.09
R4115:Psg20 UTSW 7 18685980 missense probably damaging 1.00
R4238:Psg20 UTSW 7 18684509 missense probably damaging 1.00
R5004:Psg20 UTSW 7 18680912 missense probably damaging 1.00
R6294:Psg20 UTSW 7 18682679 missense probably damaging 1.00
R6733:Psg20 UTSW 7 18674622 missense probably damaging 0.99
R6744:Psg20 UTSW 7 18674580 missense probably damaging 1.00
R6799:Psg20 UTSW 7 18684420 missense probably benign 0.06
R7466:Psg20 UTSW 7 18684467 missense probably benign 0.00
R7524:Psg20 UTSW 7 18684659 missense probably benign 0.18
Predicted Primers PCR Primer
(F):5'- TCGAAGTTGCCAGCAGCTTG -3'
(R):5'- CTCTTCAACAATCAGAGTCTTCAGC -3'

Sequencing Primer
(F):5'- GGCATGCATGATATGTACTCACG -3'
(R):5'- TCTTCAGCTCACAGAGAGGATGAC -3'
Posted On2017-05-23