Incidental Mutation 'R5306:Ifit3'
ID478097
Institutional Source Beutler Lab
Gene Symbol Ifit3
Ensembl Gene ENSMUSG00000074896
Gene Nameinterferon-induced protein with tetratricopeptide repeats 3
SynonymsIfi49
MMRRC Submission 042889-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5306 (G1)
Quality Score46
Status Validated
Chromosome19
Chromosomal Location34583531-34588731 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 34587807 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 251 (Y251C)
Ref Sequence ENSEMBL: ENSMUSP00000099889 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102825]
Predicted Effect probably damaging
Transcript: ENSMUST00000102825
AA Change: Y251C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099889
Gene: ENSMUSG00000074896
AA Change: Y251C

DomainStartEndE-ValueType
TPR 51 84 7.69e1 SMART
TPR 94 127 2.84e1 SMART
TPR 136 169 5.69e0 SMART
Blast:TPR 170 206 6e-6 BLAST
low complexity region 209 218 N/A INTRINSIC
TPR 241 274 1.02e1 SMART
Meta Mutation Damage Score 0.9408 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 97% (64/66)
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik A G 19: 29,729,830 probably benign Het
Adam29 T A 8: 55,871,757 D554V probably damaging Het
Ankrd44 G A 1: 54,926,203 probably benign Het
Api5 A T 2: 94,423,466 C297* probably null Het
Asb14 G A 14: 26,911,909 C357Y probably damaging Het
Brdt T A 5: 107,345,144 D112E probably damaging Het
Capsl C A 15: 9,457,790 Q32K probably benign Het
Ccdc106 A G 7: 5,058,097 D81G probably damaging Het
Cep104 C A 4: 154,006,242 T884K probably benign Het
Cmbl T C 15: 31,582,069 Y71H probably damaging Het
Crybg3 A T 16: 59,559,993 probably benign Het
Dynlt1c T C 17: 6,601,811 M1T probably null Het
Erbb2 T C 11: 98,428,206 S574P probably benign Het
Exosc10 T C 4: 148,562,392 V153A probably benign Het
Faxc G T 4: 21,931,557 probably benign Het
Fcgbp A G 7: 28,091,818 T835A probably damaging Het
Fmo5 G T 3: 97,641,760 M241I probably benign Het
Gabra1 A C 11: 42,133,552 I432S probably benign Het
Gfap A G 11: 102,895,748 probably null Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gm12185 T A 11: 48,915,555 M270L probably benign Het
Gm14443 T C 2: 175,169,579 N358S possibly damaging Het
Gm6583 T C 5: 112,355,044 R265G probably benign Het
Gpr3 C T 4: 133,211,179 V61M probably damaging Het
Herc2 C T 7: 56,184,961 T3229M probably damaging Het
Inf2 G A 12: 112,601,553 V180I probably benign Het
Ints11 T C 4: 155,875,208 Y91H probably damaging Het
Ints4 A C 7: 97,509,678 D419A probably damaging Het
Kmt2e T C 5: 23,499,333 S1175P probably damaging Het
Mki67 A T 7: 135,714,001 V44E probably damaging Het
Mrgprb13 A T 7: 48,312,192 noncoding transcript Het
Myh2 T C 11: 67,186,556 L839P probably damaging Het
Nos1ap T A 1: 170,349,399 K145M probably damaging Het
Olfr723 A G 14: 49,929,550 probably benign Het
Olfr814 A C 10: 129,873,941 I272R probably damaging Het
Pced1a T A 2: 130,419,171 H422L probably benign Het
Plpp1 G T 13: 112,851,555 probably null Het
Plxna4 T C 6: 32,206,121 Y949C probably damaging Het
Polg2 G A 11: 106,778,970 T158I probably damaging Het
Prss38 A T 11: 59,372,995 I297K probably benign Het
Psph A G 5: 129,769,367 L98P probably damaging Het
Rab11b G A 17: 33,760,269 probably benign Het
Rsf1 CGGCGGC CGGCGGCGGGGGCGGC 7: 97,579,929 probably benign Het
Serpine3 G A 14: 62,670,933 A137T probably damaging Het
Sh3bp4 T C 1: 89,144,275 F282L probably damaging Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Slco2b1 T A 7: 99,688,991 Y109F possibly damaging Het
Slfn10-ps T A 11: 83,035,529 noncoding transcript Het
Smc5 A G 19: 23,259,645 probably null Het
Smyd4 A G 11: 75,402,158 N638S probably benign Het
Stxbp5 T C 10: 9,799,991 E628G probably damaging Het
Tmem236 A T 2: 14,219,164 K255* probably null Het
Ttc29 T A 8: 78,251,910 probably null Het
Ttc37 G A 13: 76,147,767 E1050K possibly damaging Het
Tyr A G 7: 87,438,014 I430T probably damaging Het
Uckl1 A G 2: 181,574,367 probably null Het
Vmn2r52 A C 7: 10,170,745 I389R possibly damaging Het
Wdr62 A T 7: 30,265,263 F352Y possibly damaging Het
Wdr70 T C 15: 7,924,273 D379G probably benign Het
Zfp408 T A 2: 91,646,345 M155L probably benign Het
Zfp459 T A 13: 67,413,130 Q66H probably damaging Het
Zfp870 C A 17: 32,883,653 G234V probably damaging Het
Other mutations in Ifit3
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1501:Ifit3 UTSW 19 34588251 missense probably benign 0.13
R1521:Ifit3 UTSW 19 34587173 missense probably damaging 1.00
R3084:Ifit3 UTSW 19 34587240 missense probably damaging 0.99
R5017:Ifit3 UTSW 19 34587192 missense possibly damaging 0.78
R6194:Ifit3 UTSW 19 34587627 missense probably benign 0.06
R6523:Ifit3 UTSW 19 34588155 missense probably benign 0.10
R6559:Ifit3 UTSW 19 34587114 missense probably damaging 1.00
R7535:Ifit3 UTSW 19 34587880 missense probably damaging 0.98
R8049:Ifit3 UTSW 19 34588080 missense possibly damaging 0.88
R8142:Ifit3 UTSW 19 34587501 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAAGCAGTTCTCCGTGGATG -3'
(R):5'- AGTCTTCTGCATGAACTCCATC -3'

Sequencing Primer
(F):5'- CTCCGTGGATGCTCTGAAG -3'
(R):5'- GCATGAACTCCATCGTTAATCG -3'
Posted On2017-05-23