Incidental Mutation 'R5335:Sp110'
ID478098
Institutional Source Beutler Lab
Gene Symbol Sp110
Ensembl Gene ENSMUSG00000070034
Gene NameSp110 nuclear body protein
Synonyms5830484A20Rik, Ipr1, Ifi75, 5031415C07Rik, 52kDa
MMRRC Submission 042916-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.651) question?
Stock #R5335 (G1)
Quality Score20
Status Validated
Chromosome1
Chromosomal Location85576899-85598817 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 85589118 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 219 (E219D)
Ref Sequence ENSEMBL: ENSMUSP00000091226 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093508]
PDB Structure
Solution structure of the SAND domain of the putative nuclear protein homolog (5830484A20Rik) [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000093508
AA Change: E219D

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000091226
Gene: ENSMUSG00000070034
AA Change: E219D

DomainStartEndE-ValueType
Pfam:Sp100 8 106 2.3e-41 PFAM
low complexity region 242 254 N/A INTRINSIC
low complexity region 259 269 N/A INTRINSIC
SAND 360 433 3.55e-28 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128339
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131950
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143363
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186740
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency 98% (62/63)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010003K11Rik A G 19: 4,498,264 W86R probably damaging Het
Als2cr11b T A 1: 59,004,234 noncoding transcript Het
Ankrd6 T C 4: 32,818,651 E225G probably damaging Het
Armc4 A T 18: 7,294,566 Y16N probably benign Het
Atxn10 A G 15: 85,336,584 probably null Het
Bcas2 A G 3: 103,175,635 I146V probably damaging Het
Cachd1 G A 4: 100,968,085 V579I possibly damaging Het
Col11a1 A G 3: 114,095,240 T311A unknown Het
Cyp2c50 A T 19: 40,090,616 L134F probably benign Het
Cyp2j11 T C 4: 96,307,352 H369R probably damaging Het
Dis3 A G 14: 99,097,653 V171A possibly damaging Het
Dnah12 A G 14: 26,879,738 N3718D probably damaging Het
Dnah17 T C 11: 118,112,514 I541V probably damaging Het
Eif3i T C 4: 129,595,186 D86G probably benign Het
Epc1 C T 18: 6,490,689 probably benign Het
Epc2 A G 2: 49,513,230 N110S probably benign Het
Epha8 A T 4: 136,931,935 L831Q probably damaging Het
Esd G T 14: 74,742,113 R119I probably damaging Het
F2 T C 2: 91,634,932 K96E possibly damaging Het
Fcgbp T C 7: 28,089,734 V575A probably damaging Het
Gad1-ps G A 10: 99,445,147 noncoding transcript Het
Gemin6 T C 17: 80,225,755 V39A probably damaging Het
Glmp G T 3: 88,326,655 probably benign Het
Gm10306 C A 4: 94,556,807 probably benign Het
Gm4846 A T 1: 166,497,453 L23* probably null Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Grik1 CGG CGGG 16: 87,923,194 probably null Het
Ifi203 T C 1: 173,926,919 T749A possibly damaging Het
Kcnip2 C A 19: 45,794,246 A133S probably benign Het
Limch1 A T 5: 66,881,957 I76F probably damaging Het
Mcph1 T A 8: 18,689,061 probably null Het
Myh7 A G 14: 54,986,563 probably benign Het
Olfr11 A C 13: 21,638,779 V248G probably damaging Het
Olfr1106 T G 2: 87,049,165 K24Q probably damaging Het
Olfr346 A T 2: 36,688,094 I31F probably benign Het
Olfr54 A C 11: 51,027,334 N111H probably benign Het
Olfr583 A C 7: 103,051,535 D79A probably damaging Het
Olfr601 A C 7: 103,358,522 L224R probably damaging Het
Olfr700 A C 7: 106,805,734 S243A probably damaging Het
Opcml A G 9: 28,675,325 D113G possibly damaging Het
Pcdhb1 G T 18: 37,267,255 C753F probably benign Het
Phip T C 9: 82,900,756 S879G possibly damaging Het
Pi4k2b A G 5: 52,741,756 D13G possibly damaging Het
Ptpn18 A T 1: 34,463,178 I68F probably damaging Het
Rnf168 C T 16: 32,298,584 T321I possibly damaging Het
Soga3 A T 10: 29,147,106 I150L probably benign Het
Srgap1 C T 10: 121,785,377 probably benign Het
Sry A T Y: 2,663,647 H4Q probably benign Het
Taf2 G A 15: 55,045,740 A703V probably benign Het
Taf5l A G 8: 124,003,651 F65L probably damaging Het
Tcp10b T C 17: 13,063,067 probably null Het
Timm44 A T 8: 4,266,814 I273N probably damaging Het
Tspan4 A G 7: 141,489,615 T43A probably damaging Het
Ube2r2 T C 4: 41,190,846 probably benign Het
Urgcp T C 11: 5,717,754 T195A possibly damaging Het
Vmn1r197 T C 13: 22,328,191 I94T probably damaging Het
Vmn2r15 A T 5: 109,286,807 I677K probably damaging Het
Zfp853 T A 5: 143,288,563 H434L unknown Het
Other mutations in Sp110
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00503:Sp110 APN 1 85577329 missense probably benign
IGL00510:Sp110 APN 1 85577329 missense probably benign
IGL00516:Sp110 APN 1 85577329 missense probably benign
IGL00990:Sp110 APN 1 85586281 missense possibly damaging 0.51
IGL03382:Sp110 APN 1 85577329 missense probably benign
FR4342:Sp110 UTSW 1 85587488 small insertion probably benign
FR4976:Sp110 UTSW 1 85587489 small insertion probably benign
IGL03147:Sp110 UTSW 1 85591567 frame shift probably null
PIT4131001:Sp110 UTSW 1 85586250 missense probably benign 0.05
PIT4131001:Sp110 UTSW 1 85586254 missense probably benign 0.01
PIT4142001:Sp110 UTSW 1 85586250 missense probably benign 0.05
PIT4142001:Sp110 UTSW 1 85586254 missense probably benign 0.01
R0472:Sp110 UTSW 1 85589120 missense possibly damaging 0.79
R0483:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R0551:Sp110 UTSW 1 85589100 splice site probably benign
R0638:Sp110 UTSW 1 85577329 missense probably benign
R0806:Sp110 UTSW 1 85586254 missense probably benign 0.01
R0806:Sp110 UTSW 1 85586281 missense possibly damaging 0.51
R1074:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R1079:Sp110 UTSW 1 85589104 splice site probably benign
R1228:Sp110 UTSW 1 85591760 missense probably benign 0.03
R1403:Sp110 UTSW 1 85579079 missense probably benign 0.00
R1406:Sp110 UTSW 1 85579079 missense probably benign 0.00
R1418:Sp110 UTSW 1 85594385 missense probably benign 0.08
R1718:Sp110 UTSW 1 85594385 missense probably benign 0.08
R1744:Sp110 UTSW 1 85594372 missense probably benign 0.26
R1747:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R1806:Sp110 UTSW 1 85596110 critical splice acceptor site probably null
R1957:Sp110 UTSW 1 85577329 missense probably benign
R2404:Sp110 UTSW 1 85577329 missense probably benign
R2964:Sp110 UTSW 1 85577329 missense probably benign
R3176:Sp110 UTSW 1 85577329 missense probably benign
R4190:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R4398:Sp110 UTSW 1 85577329 missense probably benign
R4505:Sp110 UTSW 1 85589173 missense probably damaging 1.00
R4565:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R4625:Sp110 UTSW 1 85577329 missense probably benign
R4922:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R4986:Sp110 UTSW 1 85591760 missense probably benign 0.03
R5014:Sp110 UTSW 1 85577329 missense probably benign
R5080:Sp110 UTSW 1 85596055 nonsense probably null
R5087:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R5254:Sp110 UTSW 1 85577202 utr 3 prime probably benign
R5353:Sp110 UTSW 1 85589120 missense possibly damaging 0.79
R5383:Sp110 UTSW 1 85591569 frame shift probably null
R5387:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R5389:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R5398:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R5443:Sp110 UTSW 1 85589120 missense possibly damaging 0.79
R5447:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R5729:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R5752:Sp110 UTSW 1 85577202 utr 3 prime probably benign
R5754:Sp110 UTSW 1 85577202 utr 3 prime probably benign
R5799:Sp110 UTSW 1 85577329 missense probably benign
R6027:Sp110 UTSW 1 85577318 missense possibly damaging 0.83
R6171:Sp110 UTSW 1 85577329 missense probably benign
R6367:Sp110 UTSW 1 85594292 missense probably benign 0.00
R6771:Sp110 UTSW 1 85592279 intron probably null
R7097:Sp110 UTSW 1 85579685 missense possibly damaging 0.80
R7519:Sp110 UTSW 1 85579092 missense
R7520:Sp110 UTSW 1 85579092 missense
R7594:Sp110 UTSW 1 85579092 missense
R7596:Sp110 UTSW 1 85579092 missense
R7598:Sp110 UTSW 1 85579092 missense
R7600:Sp110 UTSW 1 85579092 missense
R7601:Sp110 UTSW 1 85579092 missense
R7602:Sp110 UTSW 1 85579092 missense
R7640:Sp110 UTSW 1 85579092 missense
R7641:Sp110 UTSW 1 85579092 missense
R7674:Sp110 UTSW 1 85579092 missense
R7691:Sp110 UTSW 1 85579092 missense
R7695:Sp110 UTSW 1 85579092 missense
R8072:Sp110 UTSW 1 85587486 small insertion probably benign
X0035:Sp110 UTSW 1 85586254 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AAGCTATCCCAAGCAAGGTTG -3'
(R):5'- TGCCTTCCTTACTGGTTAGAATCA -3'

Sequencing Primer
(F):5'- GTTGCTAAGAGTTAAGTCAGCC -3'
(R):5'- GGTTAGAATCACTGTTCTCTTTACTG -3'
Posted On2017-05-23