Incidental Mutation 'R5335:Atxn10'
ID478100
Institutional Source Beutler Lab
Gene Symbol Atxn10
Ensembl Gene ENSMUSG00000016541
Gene Nameataxin 10
SynonymsTEG-169, Sca10, E46, Tex169
MMRRC Submission 042916-MU
Accession Numbers

Genbank: NM_016843: MGI: 1859293

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5335 (G1)
Quality Score34
Status Validated
Chromosome15
Chromosomal Location85336245-85463212 bp(+) (GRCm38)
Type of Mutationsplice site (4 bp from exon)
DNA Base Change (assembly) A to G at 85336584 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000132450 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000163242]
Predicted Effect probably null
Transcript: ENSMUST00000163242
SMART Domains Protein: ENSMUSP00000132450
Gene: ENSMUSG00000016541

DomainStartEndE-ValueType
Pfam:Atx10homo_assoc 370 467 4.7e-38 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that may function in neuron survival, neuron differentiation, and neuritogenesis. These roles may be carried out via activation of the mitogen-activated protein kinase cascade. Expansion of an ATTCT repeat from 9-32 copies to 800-4500 copies in an intronic region of this locus has been associated with spinocerebellar ataxia, type 10. Alternatively spliced transcript variants have been described.[provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygous null mice die at early postimplantation stages. [provided by MGI curators]
Allele List at MGI

All alleles(20) : Gene trapped(20)

Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010003K11Rik A G 19: 4,498,264 W86R probably damaging Het
Als2cr11b T A 1: 59,004,234 noncoding transcript Het
Ankrd6 T C 4: 32,818,651 E225G probably damaging Het
Armc4 A T 18: 7,294,566 Y16N probably benign Het
Bcas2 A G 3: 103,175,635 I146V probably damaging Het
Cachd1 G A 4: 100,968,085 V579I possibly damaging Het
Col11a1 A G 3: 114,095,240 T311A unknown Het
Cyp2c50 A T 19: 40,090,616 L134F probably benign Het
Cyp2j11 T C 4: 96,307,352 H369R probably damaging Het
Dis3 A G 14: 99,097,653 V171A possibly damaging Het
Dnah12 A G 14: 26,879,738 N3718D probably damaging Het
Dnah17 T C 11: 118,112,514 I541V probably damaging Het
Eif3i T C 4: 129,595,186 D86G probably benign Het
Epc1 C T 18: 6,490,689 probably benign Het
Epc2 A G 2: 49,513,230 N110S probably benign Het
Epha8 A T 4: 136,931,935 L831Q probably damaging Het
Esd G T 14: 74,742,113 R119I probably damaging Het
F2 T C 2: 91,634,932 K96E possibly damaging Het
Fcgbp T C 7: 28,089,734 V575A probably damaging Het
Gad1-ps G A 10: 99,445,147 noncoding transcript Het
Gemin6 T C 17: 80,225,755 V39A probably damaging Het
Glmp G T 3: 88,326,655 probably benign Het
Gm10306 C A 4: 94,556,807 probably benign Het
Gm4846 A T 1: 166,497,453 L23* probably null Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Grik1 CGG CGGG 16: 87,923,194 probably null Het
Ifi203 T C 1: 173,926,919 T749A possibly damaging Het
Kcnip2 C A 19: 45,794,246 A133S probably benign Het
Limch1 A T 5: 66,881,957 I76F probably damaging Het
Mcph1 T A 8: 18,689,061 probably null Het
Myh7 A G 14: 54,986,563 probably benign Het
Olfr11 A C 13: 21,638,779 V248G probably damaging Het
Olfr1106 T G 2: 87,049,165 K24Q probably damaging Het
Olfr346 A T 2: 36,688,094 I31F probably benign Het
Olfr54 A C 11: 51,027,334 N111H probably benign Het
Olfr583 A C 7: 103,051,535 D79A probably damaging Het
Olfr601 A C 7: 103,358,522 L224R probably damaging Het
Olfr700 A C 7: 106,805,734 S243A probably damaging Het
Opcml A G 9: 28,675,325 D113G possibly damaging Het
Pcdhb1 G T 18: 37,267,255 C753F probably benign Het
Phip T C 9: 82,900,756 S879G possibly damaging Het
Pi4k2b A G 5: 52,741,756 D13G possibly damaging Het
Ptpn18 A T 1: 34,463,178 I68F probably damaging Het
Rnf168 C T 16: 32,298,584 T321I possibly damaging Het
Soga3 A T 10: 29,147,106 I150L probably benign Het
Sp110 C G 1: 85,589,118 E219D probably damaging Het
Srgap1 C T 10: 121,785,377 probably benign Het
Sry A T Y: 2,663,647 H4Q probably benign Het
Taf2 G A 15: 55,045,740 A703V probably benign Het
Taf5l A G 8: 124,003,651 F65L probably damaging Het
Tcp10b T C 17: 13,063,067 probably null Het
Timm44 A T 8: 4,266,814 I273N probably damaging Het
Tspan4 A G 7: 141,489,615 T43A probably damaging Het
Ube2r2 T C 4: 41,190,846 probably benign Het
Urgcp T C 11: 5,717,754 T195A possibly damaging Het
Vmn1r197 T C 13: 22,328,191 I94T probably damaging Het
Vmn2r15 A T 5: 109,286,807 I677K probably damaging Het
Zfp853 T A 5: 143,288,563 H434L unknown Het
Other mutations in Atxn10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00975:Atxn10 APN 15 85336465 start codon destroyed probably benign 0.33
IGL01020:Atxn10 APN 15 85375422 splice site probably null
IGL01380:Atxn10 APN 15 85376695 nonsense probably null
IGL01408:Atxn10 APN 15 85376695 nonsense probably null
3-1:Atxn10 UTSW 15 85438094 splice site probably benign
R0190:Atxn10 UTSW 15 85336529 missense possibly damaging 0.84
R0319:Atxn10 UTSW 15 85365282 missense probably damaging 1.00
R1437:Atxn10 UTSW 15 85359474 missense possibly damaging 0.47
R1746:Atxn10 UTSW 15 85376663 missense probably damaging 1.00
R2050:Atxn10 UTSW 15 85365312 missense probably benign 0.37
R3055:Atxn10 UTSW 15 85387005 missense probably benign 0.03
R4559:Atxn10 UTSW 15 85438120 missense possibly damaging 0.81
R4786:Atxn10 UTSW 15 85387143 missense probably benign 0.03
R4799:Atxn10 UTSW 15 85376708 splice site probably null
R4831:Atxn10 UTSW 15 85387059 missense probably benign 0.01
R5323:Atxn10 UTSW 15 85391743 missense probably benign 0.00
R5355:Atxn10 UTSW 15 85462314 missense probably damaging 1.00
R5768:Atxn10 UTSW 15 85393420 missense probably benign 0.01
R6260:Atxn10 UTSW 15 85462411 missense probably benign 0.38
R6277:Atxn10 UTSW 15 85391692 missense probably benign 0.05
R6370:Atxn10 UTSW 15 85393385 missense probably damaging 1.00
R6645:Atxn10 UTSW 15 85376703 critical splice donor site probably null
R6957:Atxn10 UTSW 15 85336498 missense probably damaging 1.00
R7859:Atxn10 UTSW 15 85462325 missense probably benign 0.01
R8031:Atxn10 UTSW 15 85393393 missense probably benign
Predicted Primers PCR Primer
(F):5'- TATTCTGTCCTCTGACGGGG -3'
(R):5'- TCTTAGAGCCTGGCCAAACC -3'

Sequencing Primer
(F):5'- TGAGGCAAGCCAGCTAGTCTC -3'
(R):5'- TGGCCAAACCCTCGTCC -3'
Posted On2017-05-23