Incidental Mutation 'R5170:Eno3'
ID478108
Institutional Source Beutler Lab
Gene Symbol Eno3
Ensembl Gene ENSMUSG00000060600
Gene Nameenolase 3, beta muscle
SynonymsEno-3
MMRRC Submission 042750-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.689) question?
Stock #R5170 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location70657202-70662513 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 70662214 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 393 (I393V)
Ref Sequence ENSEMBL: ENSMUSP00000128714 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018431] [ENSMUST00000072841] [ENSMUST00000108548] [ENSMUST00000126241] [ENSMUST00000129434] [ENSMUST00000134087] [ENSMUST00000157027] [ENSMUST00000170716]
Predicted Effect probably benign
Transcript: ENSMUST00000018431
SMART Domains Protein: ENSMUSP00000018431
Gene: ENSMUSG00000018287

DomainStartEndE-ValueType
R3H 31 109 3.85e-21 SMART
low complexity region 130 152 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000072841
AA Change: I393V

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000072620
Gene: ENSMUSG00000060600
AA Change: I393V

DomainStartEndE-ValueType
Enolase_N 3 134 6.26e-91 SMART
Enolase_C 142 431 8.8e-200 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108548
AA Change: I393V

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000104188
Gene: ENSMUSG00000060600
AA Change: I393V

DomainStartEndE-ValueType
Enolase_N 3 134 6.26e-91 SMART
Enolase_C 142 431 8.8e-200 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124691
Predicted Effect probably benign
Transcript: ENSMUST00000126241
SMART Domains Protein: ENSMUSP00000123688
Gene: ENSMUSG00000060600

DomainStartEndE-ValueType
Enolase_N 3 70 7.82e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129434
SMART Domains Protein: ENSMUSP00000115098
Gene: ENSMUSG00000018287

DomainStartEndE-ValueType
R3H 22 99 3.06e-15 SMART
low complexity region 120 142 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000134087
SMART Domains Protein: ENSMUSP00000121640
Gene: ENSMUSG00000060600

DomainStartEndE-ValueType
Enolase_N 3 78 3.53e-26 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137691
Predicted Effect probably benign
Transcript: ENSMUST00000157027
SMART Domains Protein: ENSMUSP00000115726
Gene: ENSMUSG00000060600

DomainStartEndE-ValueType
Enolase_N 3 134 6.26e-91 SMART
Pfam:Enolase_C 142 196 1e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170716
AA Change: I393V

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000128714
Gene: ENSMUSG00000060600
AA Change: I393V

DomainStartEndE-ValueType
Enolase_N 3 134 6.26e-91 SMART
Enolase_C 142 431 8.8e-200 SMART
Predicted Effect unknown
Transcript: ENSMUST00000179055
AA Change: I173V
Predicted Effect noncoding transcript
Transcript: ENSMUST00000179738
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes one of the three enolase isoenzymes found in vertebrates. Enolase is a dimeric enzyme that converts 2-phosphoglycerate to phosphoenolpyruvate as part of the glycolytic pathway. This isozyme is found in skeletal muscle where it is involved in muscle development and regeneration. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acox3 A G 5: 35,588,625 I51V probably benign Het
Agbl2 A G 2: 90,803,197 K559R probably benign Het
Arhgap30 A G 1: 171,408,050 D664G probably benign Het
BC034090 A G 1: 155,213,650 V798A probably damaging Het
Bdp1 A T 13: 100,030,794 C2237* probably null Het
C3 C T 17: 57,223,938 V388M probably damaging Het
Ccdc170 G A 10: 4,514,200 E60K probably damaging Het
Cdh8 G A 8: 99,279,550 T135M probably damaging Het
Cep131 G T 11: 120,070,609 A572E probably damaging Het
Clec16a A G 16: 10,741,791 Y976C probably benign Het
Dmpk C G 7: 19,088,019 L301V probably benign Het
Fbxo47 A G 11: 97,857,694 V305A probably benign Het
Fry G A 5: 150,429,854 V1779M probably benign Het
Gm15293 A T 8: 21,201,680 D26V probably damaging Het
Gtse1 T C 15: 85,864,264 probably null Het
Gucy2e A T 11: 69,235,570 L328Q probably damaging Het
Ifi207 T C 1: 173,730,498 T225A unknown Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Lamc3 A T 2: 31,887,344 M1L probably benign Het
Lman1l G A 9: 57,615,619 R153* probably null Het
Myo16 A G 8: 10,569,745 D1432G probably benign Het
Nwd2 A T 5: 63,806,037 N988I probably damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Parp14 T C 16: 35,857,279 E773G probably benign Het
Psen1 T A 12: 83,714,862 M146K probably damaging Het
Ptx4 G A 17: 25,123,178 R209Q probably benign Het
Slc13a2 T C 11: 78,400,808 T340A probably damaging Het
St8sia1 T C 6: 142,963,708 K21E probably damaging Het
Stxbp1 T C 2: 32,794,674 D581G probably benign Het
Sumo2 G A 11: 115,534,660 probably benign Het
Supt5 G A 7: 28,316,083 P910S probably benign Het
Tbc1d30 T C 10: 121,306,838 Q158R possibly damaging Het
Tenm2 T A 11: 36,024,806 H1968L probably damaging Het
Trmt1 T C 8: 84,695,232 Y220H probably damaging Het
Trp73 C T 4: 154,104,838 E60K possibly damaging Het
Ttn A G 2: 76,787,069 Y8026H probably damaging Het
Zar1l A G 5: 150,517,585 probably null Het
Zfp740 T C 15: 102,209,205 Y117H probably damaging Het
Zfp941 G A 7: 140,812,957 probably benign Het
Zp1 C A 19: 10,920,554 V8F possibly damaging Het
Other mutations in Eno3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02479:Eno3 APN 11 70660888 splice site probably benign
IGL02591:Eno3 APN 11 70662027 missense probably damaging 1.00
IGL02868:Eno3 APN 11 70662000 missense probably damaging 1.00
R0242:Eno3 UTSW 11 70657935 missense probably null 1.00
R0242:Eno3 UTSW 11 70657935 missense probably null 1.00
R0970:Eno3 UTSW 11 70660802 missense probably damaging 1.00
R1518:Eno3 UTSW 11 70661077 nonsense probably null
R1587:Eno3 UTSW 11 70661470 missense probably damaging 0.99
R1663:Eno3 UTSW 11 70662274 critical splice donor site probably null
R1675:Eno3 UTSW 11 70658666 critical splice donor site probably null
R1758:Eno3 UTSW 11 70661425 missense possibly damaging 0.77
R3983:Eno3 UTSW 11 70661411 missense probably damaging 0.98
R4990:Eno3 UTSW 11 70658647 missense probably damaging 0.99
R4992:Eno3 UTSW 11 70658647 missense probably damaging 0.99
R6116:Eno3 UTSW 11 70661575 missense possibly damaging 0.70
R6917:Eno3 UTSW 11 70661436 missense probably benign
R7060:Eno3 UTSW 11 70661419 missense possibly damaging 0.95
R7128:Eno3 UTSW 11 70658604 missense possibly damaging 0.76
R7678:Eno3 UTSW 11 70659167 splice site probably null
R7696:Eno3 UTSW 11 70661983 missense probably benign 0.00
R7954:Eno3 UTSW 11 70661180 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GACACTTTCATCGCTGACCTTG -3'
(R):5'- TGGCCTTTGGATTACGGAAC -3'

Sequencing Primer
(F):5'- GTGGTGGGACTCTGCACAG -3'
(R):5'- AAGACAGCTTTGTCCCCAAGAG -3'
Posted On2017-05-25