Incidental Mutation 'R5170:Cep131'
ID 478109
Institutional Source Beutler Lab
Gene Symbol Cep131
Ensembl Gene ENSMUSG00000039781
Gene Name centrosomal protein 131
Synonyms Azi1, AZ1
MMRRC Submission 042750-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.944) question?
Stock # R5170 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 119955256-119977653 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 119961435 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Glutamic Acid at position 572 (A572E)
Ref Sequence ENSEMBL: ENSMUSP00000136392 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106227] [ENSMUST00000106229] [ENSMUST00000180242]
AlphaFold Q62036
Predicted Effect probably benign
Transcript: ENSMUST00000106227
AA Change: A571E

PolyPhen 2 Score 0.376 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000101834
Gene: ENSMUSG00000039781
AA Change: A571E

DomainStartEndE-ValueType
low complexity region 113 124 N/A INTRINSIC
low complexity region 238 257 N/A INTRINSIC
IQ 261 283 7.58e-2 SMART
coiled coil region 306 344 N/A INTRINSIC
low complexity region 395 409 N/A INTRINSIC
low complexity region 440 459 N/A INTRINSIC
low complexity region 561 576 N/A INTRINSIC
SCOP:d1jila_ 672 756 2e-3 SMART
low complexity region 785 803 N/A INTRINSIC
low complexity region 813 826 N/A INTRINSIC
coiled coil region 874 1053 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000106229
AA Change: A572E

PolyPhen 2 Score 0.751 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000101836
Gene: ENSMUSG00000039781
AA Change: A572E

DomainStartEndE-ValueType
low complexity region 113 124 N/A INTRINSIC
low complexity region 238 257 N/A INTRINSIC
IQ 261 283 7.58e-2 SMART
coiled coil region 306 342 N/A INTRINSIC
low complexity region 396 410 N/A INTRINSIC
low complexity region 441 460 N/A INTRINSIC
low complexity region 562 577 N/A INTRINSIC
SCOP:d1jila_ 673 757 2e-3 SMART
low complexity region 786 804 N/A INTRINSIC
low complexity region 814 827 N/A INTRINSIC
coiled coil region 875 1054 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144128
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150463
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156075
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175334
Predicted Effect probably damaging
Transcript: ENSMUST00000180242
AA Change: A572E

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000136392
Gene: ENSMUSG00000039781
AA Change: A572E

DomainStartEndE-ValueType
low complexity region 113 124 N/A INTRINSIC
low complexity region 238 257 N/A INTRINSIC
IQ 261 283 7.58e-2 SMART
coiled coil region 306 345 N/A INTRINSIC
low complexity region 396 410 N/A INTRINSIC
low complexity region 441 460 N/A INTRINSIC
low complexity region 562 577 N/A INTRINSIC
SCOP:d1jila_ 673 757 2e-3 SMART
low complexity region 786 804 N/A INTRINSIC
low complexity region 814 827 N/A INTRINSIC
coiled coil region 875 1054 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoding this gene is a centriolar satellite protein that localizes around the basal body via transport along microtubules. Knockdown in mouse fibroblasts results in a reduction in ciliogenesis. Null mutant mice display no discernible ciliary phenotypes and embryonic patterning and adult homeostasis are largely unaffected. Male mice are infertile, however, due to defects in microtubule trafficking in the sperm manchette and flagella. In addition, the protein binds to a complex of proteins associated with Bardet-Biedl syndrome called the BBSome, and depletion of this protein results in an accumulation of the BBSome in cilia. [provided by RefSeq, Oct 2014]
PHENOTYPE: Mice homozygous for a null allele exhibit partial preweaning lethality with no apparent defects in cilia formation or function. However, homozygotes display complete male infertility associated with spermiogenesis arrest, severe flagellar defects, and teratozoospermia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acox3 A G 5: 35,745,969 (GRCm39) I51V probably benign Het
Agbl2 A G 2: 90,633,541 (GRCm39) K559R probably benign Het
Arhgap30 A G 1: 171,235,618 (GRCm39) D664G probably benign Het
BC034090 A G 1: 155,089,396 (GRCm39) V798A probably damaging Het
Bdp1 A T 13: 100,167,302 (GRCm39) C2237* probably null Het
C3 C T 17: 57,530,938 (GRCm39) V388M probably damaging Het
Ccdc170 G A 10: 4,464,200 (GRCm39) E60K probably damaging Het
Cdh8 G A 8: 100,006,182 (GRCm39) T135M probably damaging Het
Clec16a A G 16: 10,559,655 (GRCm39) Y976C probably benign Het
Cplx3 G A 9: 57,522,902 (GRCm39) R153* probably null Het
Defa41 A T 8: 21,691,696 (GRCm39) D26V probably damaging Het
Dmpk C G 7: 18,821,944 (GRCm39) L301V probably benign Het
Eno3 A G 11: 70,553,040 (GRCm39) I393V probably benign Het
Fbxo47 A G 11: 97,748,520 (GRCm39) V305A probably benign Het
Fry G A 5: 150,353,319 (GRCm39) V1779M probably benign Het
Gtse1 T C 15: 85,748,465 (GRCm39) probably null Het
Gucy2e A T 11: 69,126,396 (GRCm39) L328Q probably damaging Het
Ifi207 T C 1: 173,558,064 (GRCm39) T225A unknown Het
Igkv4-80 A C 6: 68,993,649 (GRCm39) S81A probably benign Het
Lamc3 A T 2: 31,777,356 (GRCm39) M1L probably benign Het
Myo16 A G 8: 10,619,745 (GRCm39) D1432G probably benign Het
Nwd2 A T 5: 63,963,380 (GRCm39) N988I probably damaging Het
Otx1 C A 11: 21,947,037 (GRCm39) A91S probably damaging Het
Parp14 T C 16: 35,677,649 (GRCm39) E773G probably benign Het
Psen1 T A 12: 83,761,636 (GRCm39) M146K probably damaging Het
Ptx4 G A 17: 25,342,152 (GRCm39) R209Q probably benign Het
Slc13a2 T C 11: 78,291,634 (GRCm39) T340A probably damaging Het
St8sia1 T C 6: 142,909,434 (GRCm39) K21E probably damaging Het
Stxbp1 T C 2: 32,684,686 (GRCm39) D581G probably benign Het
Sumo2 G A 11: 115,425,486 (GRCm39) probably benign Het
Supt5 G A 7: 28,015,508 (GRCm39) P910S probably benign Het
Tbc1d30 T C 10: 121,142,743 (GRCm39) Q158R possibly damaging Het
Tenm2 T A 11: 35,915,633 (GRCm39) H1968L probably damaging Het
Trmt1 T C 8: 85,421,861 (GRCm39) Y220H probably damaging Het
Trp73 C T 4: 154,189,295 (GRCm39) E60K possibly damaging Het
Ttn A G 2: 76,617,413 (GRCm39) Y8026H probably damaging Het
Zar1l A G 5: 150,441,050 (GRCm39) probably null Het
Zfp740 T C 15: 102,117,640 (GRCm39) Y117H probably damaging Het
Zfp941 G A 7: 140,392,870 (GRCm39) probably benign Het
Zp1 C A 19: 10,897,918 (GRCm39) V8F possibly damaging Het
Other mutations in Cep131
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01432:Cep131 APN 11 119,967,835 (GRCm39) missense possibly damaging 0.55
IGL01522:Cep131 APN 11 119,957,989 (GRCm39) missense probably benign 0.09
IGL01524:Cep131 APN 11 119,956,786 (GRCm39) missense probably damaging 1.00
IGL02477:Cep131 APN 11 119,961,406 (GRCm39) missense probably damaging 1.00
R0565:Cep131 UTSW 11 119,964,588 (GRCm39) missense probably damaging 0.97
R1731:Cep131 UTSW 11 119,967,742 (GRCm39) splice site probably null
R1739:Cep131 UTSW 11 119,974,732 (GRCm39) missense probably benign 0.01
R1797:Cep131 UTSW 11 119,964,562 (GRCm39) splice site probably null
R2444:Cep131 UTSW 11 119,961,321 (GRCm39) missense probably damaging 1.00
R2899:Cep131 UTSW 11 119,962,854 (GRCm39) missense probably benign 0.01
R3854:Cep131 UTSW 11 119,958,011 (GRCm39) nonsense probably null
R3856:Cep131 UTSW 11 119,958,011 (GRCm39) nonsense probably null
R4446:Cep131 UTSW 11 119,955,645 (GRCm39) missense probably damaging 1.00
R4624:Cep131 UTSW 11 119,961,658 (GRCm39) missense probably damaging 1.00
R4838:Cep131 UTSW 11 119,966,982 (GRCm39) missense probably damaging 1.00
R4892:Cep131 UTSW 11 119,958,883 (GRCm39) missense probably damaging 0.99
R6128:Cep131 UTSW 11 119,956,801 (GRCm39) missense probably damaging 1.00
R6179:Cep131 UTSW 11 119,956,837 (GRCm39) missense probably benign 0.13
R6362:Cep131 UTSW 11 119,955,516 (GRCm39) missense probably damaging 0.99
R6630:Cep131 UTSW 11 119,964,641 (GRCm39) missense probably damaging 1.00
R6786:Cep131 UTSW 11 119,956,218 (GRCm39) missense probably damaging 1.00
R6846:Cep131 UTSW 11 119,956,517 (GRCm39) missense probably damaging 1.00
R6847:Cep131 UTSW 11 119,956,517 (GRCm39) missense probably damaging 1.00
R7210:Cep131 UTSW 11 119,955,615 (GRCm39) missense probably damaging 0.96
R7569:Cep131 UTSW 11 119,957,539 (GRCm39) missense probably damaging 1.00
R8380:Cep131 UTSW 11 119,967,854 (GRCm39) missense probably damaging 1.00
R8794:Cep131 UTSW 11 119,972,074 (GRCm39) missense probably benign 0.01
R9520:Cep131 UTSW 11 119,968,157 (GRCm39) missense probably benign 0.09
RF015:Cep131 UTSW 11 119,963,794 (GRCm39) critical splice acceptor site probably benign
RF054:Cep131 UTSW 11 119,963,794 (GRCm39) critical splice acceptor site probably benign
Z1177:Cep131 UTSW 11 119,956,541 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTCTTCAATCAGCTGTGATAGG -3'
(R):5'- TGGTGAGACCATGAGCTGTC -3'

Sequencing Primer
(F):5'- CTTCAATCAGCTGTGATAGGGGTAG -3'
(R):5'- TGAGACCATGAGCTGTCATCCC -3'
Posted On 2017-05-25