Incidental Mutation 'R5187:Cdhr5'
ID478112
Institutional Source Beutler Lab
Gene Symbol Cdhr5
Ensembl Gene ENSMUSG00000025497
Gene Namecadherin-related family member 5
Synonyms1810074H01Rik, Mupcdh, Mucdhl
MMRRC Submission 042766-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R5187 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location141269083-141276786 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 141274448 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 138 (E138G)
Ref Sequence ENSEMBL: ENSMUSP00000079484 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046156] [ENSMUST00000080654] [ENSMUST00000167263] [ENSMUST00000167790] [ENSMUST00000210124] [ENSMUST00000210773] [ENSMUST00000211667]
Predicted Effect probably benign
Transcript: ENSMUST00000046156
SMART Domains Protein: ENSMUSP00000041519
Gene: ENSMUSG00000038580

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
GLUCA 32 58 1.16e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000080654
AA Change: E138G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000079484
Gene: ENSMUSG00000025497
AA Change: E138G

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
CA 53 125 3.78e-2 SMART
CA 152 238 2.34e-1 SMART
Blast:CA 277 355 3e-35 BLAST
Blast:CA 388 458 3e-24 BLAST
transmembrane domain 478 500 N/A INTRINSIC
low complexity region 546 580 N/A INTRINSIC
low complexity region 634 653 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000167263
AA Change: E138G

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000127292
Gene: ENSMUSG00000025497
AA Change: E138G

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
CA 53 125 3.78e-2 SMART
CA 152 238 2.34e-1 SMART
Blast:CA 277 355 3e-35 BLAST
Blast:CA 388 458 1e-24 BLAST
low complexity region 462 476 N/A INTRINSIC
low complexity region 496 518 N/A INTRINSIC
low complexity region 520 544 N/A INTRINSIC
low complexity region 559 576 N/A INTRINSIC
transmembrane domain 640 662 N/A INTRINSIC
low complexity region 708 742 N/A INTRINSIC
low complexity region 796 815 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167790
SMART Domains Protein: ENSMUSP00000128729
Gene: ENSMUSG00000038580

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
GLUCA 32 58 1.16e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000210124
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210386
Predicted Effect probably benign
Transcript: ENSMUST00000210773
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210928
Predicted Effect probably benign
Transcript: ENSMUST00000211667
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a novel mucin-like gene that is a member of the cadherin superfamily. While encoding nonpolymorphic tandem repeats rich in proline, serine and threonine similar to mucin proteins, the gene also contains sequence encoding calcium-binding motifs found in all cadherins. The role of the hybrid extracellular region and the specific function of this protein have not yet been determined. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jan 2010]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik T A 1: 105,718,809 L620* probably null Het
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
Abcg5 A G 17: 84,658,564 L628S probably damaging Het
Acbd3 C T 1: 180,736,732 R201* probably null Het
Adsl A G 15: 80,948,905 probably benign Het
Asic1 GCACC GCACCACC 15: 99,698,803 probably benign Het
Cachd1 T C 4: 100,966,200 V483A possibly damaging Het
Calm1 T C 12: 100,200,213 S19P probably benign Het
Casq1 T C 1: 172,213,074 N313S possibly damaging Het
Cav2 G T 6: 17,286,936 A64S possibly damaging Het
Ccdc114 A G 7: 45,929,116 I77V probably damaging Het
Ccdc167 C A 17: 29,705,511 A39S possibly damaging Het
Cd274 T C 19: 29,382,536 L247P probably benign Het
Cltb C T 13: 54,593,880 C81Y probably benign Het
Clvs1 T C 4: 9,281,865 L103P possibly damaging Het
Cntrob G T 11: 69,321,891 Q106K possibly damaging Het
Ctsh T C 9: 90,054,590 L14P probably damaging Het
Cubn T C 2: 13,287,568 N3268S probably damaging Het
Cyb5r4 T C 9: 87,026,948 V26A possibly damaging Het
Ddx18 A G 1: 121,562,128 I184T probably damaging Het
Ddx60 T A 8: 61,974,188 W766R probably damaging Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Dnah5 G A 15: 28,272,172 V1041I probably benign Het
Dnajc21 A T 15: 10,463,964 N38K probably benign Het
Ermap T C 4: 119,185,818 probably null Het
Fam129a T A 1: 151,703,829 L433Q possibly damaging Het
Fryl A G 5: 73,086,600 L1209P possibly damaging Het
Gm5093 T C 17: 46,439,873 E76G possibly damaging Het
Grk6 T C 13: 55,451,706 C169R probably damaging Het
Hmgn1 A T 16: 96,122,427 probably null Het
Lpcat2b T A 5: 107,434,135 Y443* probably null Het
Macf1 T A 4: 123,472,089 M1395L probably benign Het
Mllt10 C T 2: 18,208,774 Q997* probably null Het
Mocos T A 18: 24,692,554 V722E probably damaging Het
Moxd2 A T 6: 40,879,337 L534M probably benign Het
Mphosph10 T C 7: 64,385,820 M368V possibly damaging Het
Myo15 G A 11: 60,503,614 G2383D probably damaging Het
Myo5b T C 18: 74,701,674 I935T possibly damaging Het
Ndst4 T A 3: 125,437,911 L43H probably damaging Het
Nsl1 A G 1: 191,075,190 N189D probably benign Het
Olfr558 A T 7: 102,709,661 H134L probably damaging Het
Pcdh8 T C 14: 79,770,154 D323G probably damaging Het
Pkhd1 A G 1: 20,209,224 S2957P possibly damaging Het
Prdm9 T G 17: 15,562,893 E42D probably damaging Het
Rasal1 C A 5: 120,675,395 H611Q probably benign Het
Rif1 T A 2: 52,081,289 W260R probably damaging Het
Rpain A G 11: 70,973,832 D115G probably benign Het
Rpl3l T C 17: 24,732,455 V110A possibly damaging Het
Ryr2 T A 13: 11,772,452 I1012F probably damaging Het
Sema4f A G 6: 82,917,650 V480A probably benign Het
Slc35a3 T A 3: 116,681,145 K199N probably damaging Het
Slc5a6 T C 5: 31,042,978 Y121C probably damaging Het
Slc7a14 T C 3: 31,237,365 probably null Het
Sort1 T A 3: 108,324,676 I172N probably damaging Het
Spink5 C A 18: 43,989,451 H328N probably damaging Het
Tbl1xr1 A G 3: 22,209,606 D504G probably damaging Het
Tcaf3 C T 6: 42,597,020 C86Y possibly damaging Het
Tfap2e T C 4: 126,734,641 D174G probably benign Het
Tmem42 T C 9: 123,022,167 V65A probably damaging Het
Vmn1r225 C G 17: 20,502,915 T206R probably damaging Het
Vmn2r38 A G 7: 9,097,572 F65S probably benign Het
Vmn2r87 A T 10: 130,497,339 L14Q probably null Het
Xirp2 T C 2: 67,515,367 S2651P probably benign Het
Zfp429 G A 13: 67,390,840 L162F probably damaging Het
Zhx1 A T 15: 58,052,423 M809K probably damaging Het
Other mutations in Cdhr5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02097:Cdhr5 APN 7 141269981 missense probably damaging 0.99
IGL02662:Cdhr5 APN 7 141274503 missense possibly damaging 0.57
R0002:Cdhr5 UTSW 7 141270020 splice site probably null
R0098:Cdhr5 UTSW 7 141269868 missense probably damaging 1.00
R0201:Cdhr5 UTSW 7 141276378 missense probably damaging 1.00
R0494:Cdhr5 UTSW 7 141272518 missense probably damaging 1.00
R0508:Cdhr5 UTSW 7 141272899 missense probably benign 0.41
R0918:Cdhr5 UTSW 7 141272149 missense probably damaging 1.00
R1570:Cdhr5 UTSW 7 141271769 missense probably damaging 1.00
R1571:Cdhr5 UTSW 7 141272170 missense probably damaging 1.00
R1838:Cdhr5 UTSW 7 141272603 missense possibly damaging 0.93
R3912:Cdhr5 UTSW 7 141273857 missense probably damaging 1.00
R4289:Cdhr5 UTSW 7 141272839 missense probably damaging 0.99
R4491:Cdhr5 UTSW 7 141274057 missense possibly damaging 0.55
R4838:Cdhr5 UTSW 7 141273731 missense probably damaging 1.00
R4949:Cdhr5 UTSW 7 141272644 missense probably damaging 0.97
R5344:Cdhr5 UTSW 7 141276524 missense probably damaging 0.97
R5642:Cdhr5 UTSW 7 141269197 nonsense probably null
R6736:Cdhr5 UTSW 7 141272531 missense probably damaging 0.97
R7172:Cdhr5 UTSW 7 141271928 missense possibly damaging 0.90
R7212:Cdhr5 UTSW 7 141272659 missense probably damaging 0.99
R7693:Cdhr5 UTSW 7 141271778 missense probably benign
RF016:Cdhr5 UTSW 7 141272184 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- AGCTGTGTCTCAGGGATGAC -3'
(R):5'- TTGCTGCCATCAGAGCTGTG -3'

Sequencing Primer
(F):5'- CTCAGGGATGACGGTTGTATTCAC -3'
(R):5'- CTGCCATCAGAGCTGTGGAATG -3'
Posted On2017-05-25