Incidental Mutation 'R5172:Rpf1'
ID478123
Institutional Source Beutler Lab
Gene Symbol Rpf1
Ensembl Gene ENSMUSG00000028187
Gene Nameribosome production factor 1 homolog
SynonymsBxdc5, 2210420E24Rik, 2310066N05Rik
MMRRC Submission 042752-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.922) question?
Stock #R5172 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location146505956-146521429 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 146512295 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 155 (R155G)
Ref Sequence ENSEMBL: ENSMUSP00000143279 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029838] [ENSMUST00000199079]
Predicted Effect possibly damaging
Transcript: ENSMUST00000029838
AA Change: R155G

PolyPhen 2 Score 0.682 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000029838
Gene: ENSMUSG00000028187
AA Change: R155G

DomainStartEndE-ValueType
low complexity region 10 31 N/A INTRINSIC
low complexity region 71 92 N/A INTRINSIC
Brix 145 319 4.82e-54 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196909
Predicted Effect possibly damaging
Transcript: ENSMUST00000199079
AA Change: R155G

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000143279
Gene: ENSMUSG00000028187
AA Change: R155G

DomainStartEndE-ValueType
low complexity region 10 31 N/A INTRINSIC
low complexity region 71 92 N/A INTRINSIC
Pfam:Brix 146 211 4.7e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000199174
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200583
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc3 T C 11: 94,375,608 Y52C probably damaging Het
Acmsd C T 1: 127,753,848 R183* probably null Het
Anxa2 T A 9: 69,485,251 D127E probably damaging Het
Atrnl1 T A 19: 57,685,513 Y593* probably null Het
Atxn2 C T 5: 121,795,035 probably null Het
Ccl6 A T 11: 83,589,343 Y66N probably damaging Het
Ccng1 A G 11: 40,751,286 V223A probably benign Het
Cfap44 T C 16: 44,449,193 Y1187H probably benign Het
Cfc1 A T 1: 34,535,930 I10F probably benign Het
Chrne T A 11: 70,615,526 T365S probably benign Het
Clec4b1 G T 6: 123,071,455 R183L probably benign Het
Csmd2 A C 4: 128,477,397 Q1926P probably benign Het
Dmpk C G 7: 19,088,019 L301V probably benign Het
Dzip1 T A 14: 118,887,151 Q570L probably damaging Het
Fam149a T A 8: 45,344,653 Q507L probably damaging Het
Frem3 T C 8: 80,612,566 V496A probably benign Het
Fryl A T 5: 73,101,673 D589E possibly damaging Het
Hemk1 T C 9: 107,329,432 E4G possibly damaging Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Kcnh7 T C 2: 62,739,164 D796G possibly damaging Het
Lemd2 G T 17: 27,195,382 S326* probably null Het
Mdc1 T C 17: 35,853,090 S1177P probably benign Het
Mfsd4b4 A G 10: 39,894,087 F78S probably damaging Het
Mmgt2 T A 11: 62,665,128 F101I possibly damaging Het
Myo18a T C 11: 77,824,098 L785P probably damaging Het
Nup155 C A 15: 8,109,542 Q33K probably benign Het
Olfr1152 A G 2: 87,868,827 T279A probably benign Het
Olfr584 T C 7: 103,085,677 L48P probably damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pank1 A T 19: 34,840,802 C112* probably null Het
Pcmtd1 T A 1: 7,163,261 M23K probably benign Het
Rere A T 4: 150,570,269 R419S unknown Het
Sema7a A G 9: 57,957,678 T421A probably benign Het
Sharpin A G 15: 76,347,541 S323P probably benign Het
Slamf6 A G 1: 171,936,580 E180G probably benign Het
Snd1 T G 6: 28,886,616 V874G possibly damaging Het
Sult6b2 A T 6: 142,797,931 V123D probably damaging Het
Tpk1 A T 6: 43,560,017 probably null Het
Vmn1r160 A T 7: 22,871,336 N38I probably damaging Het
Wdr93 T A 7: 79,752,493 I180N probably damaging Het
Ythdf3 C T 3: 16,204,034 T119I probably damaging Het
Zc3h18 T G 8: 122,407,420 probably benign Het
Other mutations in Rpf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00492:Rpf1 APN 3 146512247 missense probably benign 0.10
IGL01371:Rpf1 APN 3 146507547 missense probably damaging 1.00
IGL01729:Rpf1 APN 3 146507149 missense probably damaging 1.00
IGL02122:Rpf1 APN 3 146521267 missense probably benign
R0196:Rpf1 UTSW 3 146508149 missense possibly damaging 0.86
R1664:Rpf1 UTSW 3 146512148 missense probably benign 0.01
R2019:Rpf1 UTSW 3 146521221 missense probably damaging 1.00
R3151:Rpf1 UTSW 3 146507635 missense probably damaging 1.00
R4989:Rpf1 UTSW 3 146506538 missense probably damaging 1.00
R5133:Rpf1 UTSW 3 146506538 missense probably damaging 1.00
R5134:Rpf1 UTSW 3 146506538 missense probably damaging 1.00
R5383:Rpf1 UTSW 3 146519391 missense possibly damaging 0.92
R5525:Rpf1 UTSW 3 146517804 splice site silent
R5927:Rpf1 UTSW 3 146519463 intron probably null
R5947:Rpf1 UTSW 3 146506544 missense probably damaging 1.00
R7070:Rpf1 UTSW 3 146512184 missense probably damaging 1.00
R7311:Rpf1 UTSW 3 146507163 missense probably benign 0.42
Y5404:Rpf1 UTSW 3 146512836 missense probably damaging 1.00
Y5405:Rpf1 UTSW 3 146512836 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATTCTGGAAGTGATGGGAAGC -3'
(R):5'- CTGAGCATAATTCTTCAGGACAG -3'

Sequencing Primer
(F):5'- GAAGTGATGGGAAGCCTTTTC -3'
(R):5'- CTGCCCAGTGTGATGATTAGCAAC -3'
Posted On2017-05-25