Incidental Mutation 'R5172:Snd1'
ID 478124
Institutional Source Beutler Lab
Gene Symbol Snd1
Ensembl Gene ENSMUSG00000001424
Gene Name staphylococcal nuclease and tudor domain containing 1
Synonyms p100 co-activator, Tudor-SN
MMRRC Submission 042752-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.933) question?
Stock # R5172 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 28475139-28935162 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 28886616 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Glycine at position 874 (V874G)
Ref Sequence ENSEMBL: ENSMUSP00000001460 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001460] [ENSMUST00000167201]
AlphaFold Q78PY7
Predicted Effect possibly damaging
Transcript: ENSMUST00000001460
AA Change: V874G

PolyPhen 2 Score 0.914 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000001460
Gene: ENSMUSG00000001424
AA Change: V874G

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
SNc 18 166 7.12e-54 SMART
SNc 193 328 8.37e-51 SMART
SNc 341 496 4.11e-59 SMART
SNc 525 660 3.82e-45 SMART
TUDOR 728 785 4.8e-19 SMART
Pfam:SNase 835 895 1.3e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165151
Predicted Effect probably benign
Transcript: ENSMUST00000167201
SMART Domains Protein: ENSMUSP00000128737
Gene: ENSMUSG00000001424

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
SNc 18 166 7.12e-54 SMART
SNc 193 328 8.37e-51 SMART
SNc 341 496 4.11e-59 SMART
SCOP:d1sty__ 526 592 1e-4 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcriptional co-activator that interacts with the acidic domain of Epstein-Barr virus nuclear antigen 2 (EBNA 2), a transcriptional activator that is required for B-lymphocyte transformation. Other transcription factors that interact with this protein are signal transducers and activators of transcription, STATs. This protein is also thought to be essential for normal cell growth. A similar protein in mammals and other organisms is a component of the RNA-induced silencing complex (RISC). [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc3 T C 11: 94,375,608 Y52C probably damaging Het
Acmsd C T 1: 127,753,848 R183* probably null Het
Anxa2 T A 9: 69,485,251 D127E probably damaging Het
Atrnl1 T A 19: 57,685,513 Y593* probably null Het
Atxn2 C T 5: 121,795,035 probably null Het
Ccl6 A T 11: 83,589,343 Y66N probably damaging Het
Ccng1 A G 11: 40,751,286 V223A probably benign Het
Cfap44 T C 16: 44,449,193 Y1187H probably benign Het
Cfc1 A T 1: 34,535,930 I10F probably benign Het
Chrne T A 11: 70,615,526 T365S probably benign Het
Clec4b1 G T 6: 123,071,455 R183L probably benign Het
Csmd2 A C 4: 128,477,397 Q1926P probably benign Het
Dmpk C G 7: 19,088,019 L301V probably benign Het
Dzip1 T A 14: 118,887,151 Q570L probably damaging Het
Fam149a T A 8: 45,344,653 Q507L probably damaging Het
Frem3 T C 8: 80,612,566 V496A probably benign Het
Fryl A T 5: 73,101,673 D589E possibly damaging Het
Hemk1 T C 9: 107,329,432 E4G possibly damaging Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Kcnh7 T C 2: 62,739,164 D796G possibly damaging Het
Lemd2 G T 17: 27,195,382 S326* probably null Het
Mdc1 T C 17: 35,853,090 S1177P probably benign Het
Mfsd4b4 A G 10: 39,894,087 F78S probably damaging Het
Mmgt2 T A 11: 62,665,128 F101I possibly damaging Het
Myo18a T C 11: 77,824,098 L785P probably damaging Het
Nup155 C A 15: 8,109,542 Q33K probably benign Het
Olfr1152 A G 2: 87,868,827 T279A probably benign Het
Olfr584 T C 7: 103,085,677 L48P probably damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pank1 A T 19: 34,840,802 C112* probably null Het
Pcmtd1 T A 1: 7,163,261 M23K probably benign Het
Rere A T 4: 150,570,269 R419S unknown Het
Rpf1 T C 3: 146,512,295 R155G possibly damaging Het
Sema7a A G 9: 57,957,678 T421A probably benign Het
Sharpin A G 15: 76,347,541 S323P probably benign Het
Slamf6 A G 1: 171,936,580 E180G probably benign Het
Sult6b2 A T 6: 142,797,931 V123D probably damaging Het
Tpk1 A T 6: 43,560,017 probably null Het
Vmn1r160 A T 7: 22,871,336 N38I probably damaging Het
Wdr93 T A 7: 79,752,493 I180N probably damaging Het
Ythdf3 C T 3: 16,204,034 T119I probably damaging Het
Zc3h18 T G 8: 122,407,420 probably benign Het
Other mutations in Snd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00933:Snd1 APN 6 28512986 critical splice donor site probably null
IGL00940:Snd1 APN 6 28745175 intron probably benign
IGL01340:Snd1 APN 6 28883369 missense probably benign
IGL01892:Snd1 APN 6 28888124 critical splice donor site probably null
IGL02063:Snd1 APN 6 28526221 unclassified probably benign
IGL02134:Snd1 APN 6 28880279 missense possibly damaging 0.81
IGL02366:Snd1 APN 6 28707150 intron probably benign
PIT4677001:Snd1 UTSW 6 28880296 missense probably benign 0.01
R0039:Snd1 UTSW 6 28745210 missense probably damaging 1.00
R0053:Snd1 UTSW 6 28745335 intron probably benign
R0053:Snd1 UTSW 6 28745335 intron probably benign
R0463:Snd1 UTSW 6 28724956 missense probably benign 0.00
R0576:Snd1 UTSW 6 28886577 missense probably benign 0.31
R0709:Snd1 UTSW 6 28545470 splice site probably benign
R0959:Snd1 UTSW 6 28884971 missense probably benign 0.01
R1698:Snd1 UTSW 6 28888253 nonsense probably null
R1853:Snd1 UTSW 6 28545564 missense probably damaging 1.00
R2059:Snd1 UTSW 6 28745207 missense probably damaging 1.00
R2497:Snd1 UTSW 6 28888079 missense probably benign
R3832:Snd1 UTSW 6 28531404 splice site probably benign
R3833:Snd1 UTSW 6 28531404 splice site probably benign
R4643:Snd1 UTSW 6 28880249 missense probably benign 0.00
R4665:Snd1 UTSW 6 28707054 missense probably damaging 1.00
R4843:Snd1 UTSW 6 28668643 missense probably damaging 1.00
R4884:Snd1 UTSW 6 28526912 missense possibly damaging 0.94
R4959:Snd1 UTSW 6 28884251 nonsense probably null
R4973:Snd1 UTSW 6 28884251 nonsense probably null
R5065:Snd1 UTSW 6 28888240 missense probably damaging 1.00
R5066:Snd1 UTSW 6 28888240 missense probably damaging 1.00
R5067:Snd1 UTSW 6 28888240 missense probably damaging 1.00
R5131:Snd1 UTSW 6 28885050 missense probably damaging 0.99
R5239:Snd1 UTSW 6 28545525 missense probably damaging 1.00
R5313:Snd1 UTSW 6 28668601 missense probably benign 0.15
R5395:Snd1 UTSW 6 28526184 missense probably damaging 0.99
R5938:Snd1 UTSW 6 28874859 critical splice acceptor site probably null
R6019:Snd1 UTSW 6 28880234 missense probably benign 0.00
R6248:Snd1 UTSW 6 28520235 nonsense probably null
R6337:Snd1 UTSW 6 28888289 missense probably damaging 1.00
R6810:Snd1 UTSW 6 28668610 missense probably benign 0.23
R6932:Snd1 UTSW 6 28626101 missense probably benign 0.42
R7469:Snd1 UTSW 6 28626127 missense probably damaging 1.00
R7485:Snd1 UTSW 6 28531450 missense probably benign 0.14
R7571:Snd1 UTSW 6 28526203 missense possibly damaging 0.81
R7866:Snd1 UTSW 6 28527725 missense probably damaging 1.00
R8178:Snd1 UTSW 6 28874976 missense possibly damaging 0.85
R8208:Snd1 UTSW 6 28526055 missense possibly damaging 0.86
R8526:Snd1 UTSW 6 28745254 missense probably benign 0.00
R8848:Snd1 UTSW 6 28874963 missense possibly damaging 0.72
R8854:Snd1 UTSW 6 28526969 missense probably benign 0.02
R9310:Snd1 UTSW 6 28795937 missense probably null 1.00
R9326:Snd1 UTSW 6 28795843 nonsense probably null
R9348:Snd1 UTSW 6 28745207 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGCGGGACATCCAAAACAC -3'
(R):5'- CAAACCCGCAGTCAATTAATTTGTG -3'

Sequencing Primer
(F):5'- ACTCAGTGCCTGCTCAACG -3'
(R):5'- TTTTAAAAACCCAACAAACCCAAATC -3'
Posted On 2017-05-25