Incidental Mutation 'R5201:Efemp1'
ID478130
Institutional Source Beutler Lab
Gene Symbol Efemp1
Ensembl Gene ENSMUSG00000020467
Gene Nameepidermal growth factor-containing fibulin-like extracellular matrix protein 1
Synonyms
MMRRC Submission 042776-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5201 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location28853204-28926743 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 28914590 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 215 (I215L)
Ref Sequence ENSEMBL: ENSMUSP00000020759 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020759]
Predicted Effect probably benign
Transcript: ENSMUST00000020759
AA Change: I215L

PolyPhen 2 Score 0.053 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000020759
Gene: ENSMUSG00000020467
AA Change: I215L

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
EGF_like 44 76 9.53e-2 SMART
low complexity region 87 104 N/A INTRINSIC
EGF_CA 173 213 5.78e-11 SMART
EGF_CA 214 253 2.35e-11 SMART
EGF_CA 254 293 1.22e-9 SMART
EGF_CA 294 333 1.35e-11 SMART
EGF_like 334 378 3.49e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124103
Predicted Effect probably benign
Transcript: ENSMUST00000139713
SMART Domains Protein: ENSMUSP00000114757
Gene: ENSMUSG00000020467

DomainStartEndE-ValueType
EGF 2 38 6.86e-4 SMART
EGF_like 39 83 3.49e-3 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the fibulin family of extracellular matrix glycoproteins. Like all members of this family, the encoded protein contains tandemly repeated epidermal growth factor-like repeats followed by a C-terminus fibulin-type domain. This gene is upregulated in malignant gliomas and may play a role in the aggressive nature of these tumors. Mutations in this gene are associated with Doyne honeycomb retinal dystrophy. Alternatively spliced transcript variants that encode the same protein have been described.[provided by RefSeq, Nov 2009]
PHENOTYPE: Mice homozygous for disruptions in this gene display a normal phenotype. Mice homozygous for a single amino acid substitution develop deposits below the retinal pigment epithelium. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik C A 15: 82,062,544 T214N probably benign Het
Actn4 A T 7: 28,916,255 probably null Het
Arap2 T C 5: 62,683,489 E678G probably damaging Het
Atl2 T C 17: 79,865,151 N130S probably benign Het
Ccdc129 T C 6: 55,968,006 S571P probably benign Het
Cyp2b10 A G 7: 25,916,994 D342G probably damaging Het
Dnah6 A G 6: 73,195,732 Y248H possibly damaging Het
Drd5 A T 5: 38,320,023 M120L probably damaging Het
Duox1 A G 2: 122,327,922 R629G probably benign Het
Dyrk1b A G 7: 28,185,096 Y279C probably damaging Het
Enpp6 C A 8: 47,065,451 Q205K probably damaging Het
Fam170a A T 18: 50,282,126 T280S probably benign Het
Fam222a G A 5: 114,611,066 A108T possibly damaging Het
Fgd3 G T 13: 49,296,378 P132T probably benign Het
Fzr1 A T 10: 81,367,528 L399H probably damaging Het
Galnt15 G A 14: 32,049,865 R289Q probably damaging Het
Hira T C 16: 18,952,115 V834A probably damaging Het
Ilf3 T C 9: 21,389,383 L93P probably damaging Het
Itgae G A 11: 73,110,556 R71Q probably benign Het
Kif14 T A 1: 136,503,407 S1181T probably benign Het
Lrig3 C A 10: 126,013,151 P946Q possibly damaging Het
Macf1 A T 4: 123,475,945 C1674* probably null Het
Malt1 A G 18: 65,476,055 K710R probably benign Het
Man1a2 A T 3: 100,617,012 N373K probably benign Het
Mkl2 A C 16: 13,401,592 T701P probably benign Het
Mpped2 A G 2: 106,699,502 N32S possibly damaging Het
Myh10 A T 11: 68,783,195 T652S probably damaging Het
Nfia A G 4: 98,111,225 Y485C probably damaging Het
Olfml2b A T 1: 170,668,864 T355S probably benign Het
Olfr1419 A T 19: 11,870,631 I195K probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pcdh1 A T 18: 38,198,918 V344D probably damaging Het
Plekhn1 C A 4: 156,230,527 V558L probably benign Het
Prr14l A G 5: 32,830,247 S635P possibly damaging Het
Prss46 T A 9: 110,851,475 C229* probably null Het
Rad50 A G 11: 53,698,820 probably null Het
Slc27a3 A T 3: 90,389,219 L191Q probably benign Het
Spert A G 14: 75,584,009 V101A probably damaging Het
Surf4 A G 2: 26,933,766 probably benign Het
Taf3 A G 2: 9,952,184 S391P probably damaging Het
Tep1 A C 14: 50,868,110 L151R probably benign Het
Tmprss11d A C 5: 86,309,355 N148K possibly damaging Het
Tpd52l2 G A 2: 181,515,086 V172I probably benign Het
Vmn2r77 A G 7: 86,811,638 D724G probably damaging Het
Wdr75 T A 1: 45,823,359 D779E probably benign Het
Zfp943 A T 17: 21,992,813 K293N probably damaging Het
Other mutations in Efemp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00816:Efemp1 APN 11 28926223 missense probably benign 0.32
IGL01862:Efemp1 APN 11 28921428 missense probably damaging 0.97
IGL02568:Efemp1 APN 11 28916971 critical splice donor site probably null
IGL03175:Efemp1 APN 11 28926259 missense probably benign 0.04
IGL03014:Efemp1 UTSW 11 28926218 missense probably damaging 0.96
R0973:Efemp1 UTSW 11 28854538 missense probably damaging 1.00
R0973:Efemp1 UTSW 11 28854538 missense probably damaging 1.00
R0974:Efemp1 UTSW 11 28854538 missense probably damaging 1.00
R1678:Efemp1 UTSW 11 28916942 missense probably benign 0.00
R1701:Efemp1 UTSW 11 28921750 missense possibly damaging 0.68
R1831:Efemp1 UTSW 11 28921442 missense possibly damaging 0.91
R2016:Efemp1 UTSW 11 28921613 missense probably damaging 1.00
R2017:Efemp1 UTSW 11 28921613 missense probably damaging 1.00
R2024:Efemp1 UTSW 11 28914696 missense possibly damaging 0.85
R2025:Efemp1 UTSW 11 28914696 missense possibly damaging 0.85
R2027:Efemp1 UTSW 11 28914696 missense possibly damaging 0.85
R2084:Efemp1 UTSW 11 28915763 missense probably damaging 1.00
R2396:Efemp1 UTSW 11 28867941 missense possibly damaging 0.83
R4803:Efemp1 UTSW 11 28921795 missense possibly damaging 0.84
R4817:Efemp1 UTSW 11 28926241 missense probably damaging 1.00
R5297:Efemp1 UTSW 11 28867868 missense probably damaging 0.99
R5534:Efemp1 UTSW 11 28867758 missense probably damaging 1.00
R5839:Efemp1 UTSW 11 28921418 missense possibly damaging 0.95
R6037:Efemp1 UTSW 11 28921760 missense probably damaging 1.00
R6037:Efemp1 UTSW 11 28921760 missense probably damaging 1.00
R6314:Efemp1 UTSW 11 28914603 missense probably benign 0.12
R7067:Efemp1 UTSW 11 28867926 missense probably damaging 1.00
R7396:Efemp1 UTSW 11 28867501 missense possibly damaging 0.92
R8223:Efemp1 UTSW 11 28854528 missense probably benign 0.13
R8243:Efemp1 UTSW 11 28921690 missense probably damaging 0.99
Z1177:Efemp1 UTSW 11 28867909 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- CTCCACTGAGAATTTGCTAAGAC -3'
(R):5'- ACAAGGCTGTCTTTTCCTGG -3'

Sequencing Primer
(F):5'- TTGCTAAGACACAACTTGGTTC -3'
(R):5'- CTGGAGGCAGGATAGCAGTTCTC -3'
Posted On2017-05-25