Mutagenetix > Incidental Mutation

Incidental Mutation 'R5202:Adam7'

478132

Institutional Source

Beutler Lab

Gene Symbol

Adam7

Ensembl Gene

ENSMUSG00000022056

Gene Name

a disintegrin and metallopeptidase domain 7

Synonyms

EAP1

MMRRC Submission

042777-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.066) question?

Stock #

R5202 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

68497336-68533741 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 68507856 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Tyrosine at position 640 (D640Y)

Ref Sequence

ENSEMBL: ENSMUSP00000022640 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022640]

AlphaFold

O35227

Predicted Effect

possibly damaging
Transcript: ENSMUST00000022640
AA Change: D640Y

PolyPhen 2 Score 0.917 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000022640
Gene: ENSMUSG00000022056
AA Change: D640Y

Domain	Start	End	E-Value	Type
Pfam:Pep_M12B_propep	25	156	1.6e-28	PFAM
Pfam:Reprolysin_5	197	378	1.2e-12	PFAM
Pfam:Reprolysin_4	197	382	2.6e-12	PFAM
Pfam:Reprolysin	199	393	1.3e-70	PFAM
Pfam:Reprolysin_2	219	383	1.1e-9	PFAM
Pfam:Reprolysin_3	223	346	9.5e-14	PFAM
DISIN	410	485	8.79e-30	SMART
ACR	486	623	3.51e-58	SMART
transmembrane domain	667	689	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128069

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.9%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of a disintegrin and metalloprotease (ADAM) family of endoproteases that play important roles in various biological processes including cell signaling, adhesion and migration. This gene is specifically expressed in epididymis where the encoded protein is transferred to the sperm surface during epididymal transit. This gene is located adjacent to a related gene from the ADAM family of proteins on chromosome 14. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced male fertility with decreased cell height in caput epididymis, spermatic granuloma, kinked sperm flagellum and reduced sperm motility. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932414N04Rik	A	T	2: 68,731,964	M312L	probably benign	Het
Alcam	T	C	16: 52,274,236	Y384C	probably damaging	Het
Apob	A	G	12: 8,013,737	E289G	probably damaging	Het
Arhgap15	A	T	2: 44,063,857	R198S	probably benign	Het
Bbs2	G	T	8: 94,092,414	S109*	probably null	Het
Bfsp1	T	C	2: 143,826,971	S569G	probably benign	Het
Chst9	A	T	18: 15,453,239	I89N	probably benign	Het
Cntln	A	C	4: 84,971,229	E316D	probably benign	Het
Csde1	T	G	3: 103,039,934	D67E	probably damaging	Het
Csf2rb	T	G	15: 78,349,057	S855A	possibly damaging	Het
Cyp4a10	T	A	4: 115,532,615	D472E	probably damaging	Het
Cyp4f18	C	A	8: 72,009,096	R49L	probably benign	Het
Daam1	G	T	12: 71,944,274	V221L	unknown	Het
Dbr1	T	G	9: 99,583,891	D507E	probably benign	Het
Dhrs7c	A	G	11: 67,815,801	M188V	probably benign	Het
Dicer1	A	T	12: 104,694,731	L1688*	probably null	Het
Dmpk	C	G	7: 19,088,019	L301V	probably benign	Het
E2f3	G	A	13: 29,918,636	T91I	probably damaging	Het
Etaa1	A	T	11: 17,947,853	V157E	probably damaging	Het
Foxp2	A	T	6: 15,394,771	T157S	probably benign	Het
Frem2	A	G	3: 53,551,346	V2034A	probably benign	Het
Fzd10	T	C	5: 128,602,116	V300A	possibly damaging	Het
Gbf1	A	T	19: 46,268,454	M778L	probably benign	Het
Gm17472	T	A	6: 42,981,134	N112K	probably benign	Het
Gria4	T	C	9: 4,424,330	K845R	probably benign	Het
Hspa4l	T	A	3: 40,781,569	S541T	probably benign	Het
Igkv4-68	G	A	6: 69,304,942	R82C	probably damaging	Het
Itgb1	A	T	8: 128,720,010	I383F	probably damaging	Het
Kcnk12	T	A	17: 87,746,605	K210*	probably null	Het
Limch1	C	G	5: 66,993,173	D163E	probably damaging	Het
Mbd4	A	T	6: 115,849,402	D188E	probably damaging	Het
Myh9	C	T	15: 77,781,110		probably null	Het
Nbeal2	T	C	9: 110,644,666	E28G	probably damaging	Het
Nfatc4	A	G	14: 55,826,659	E201G	probably damaging	Het
Nrap	G	A	19: 56,335,151	H1330Y	probably damaging	Het
Nudt14	A	G	12: 112,935,028	S151P	probably damaging	Het
Olfr297	C	A	7: 86,527,116	R120S	probably damaging	Het
Olfr58	T	A	9: 19,783,218	F28L	possibly damaging	Het
Olfr706	T	A	7: 106,886,596	T74S	possibly damaging	Het
Otx1	C	A	11: 21,997,037	A91S	probably damaging	Het
Paqr9	A	G	9: 95,560,110	D51G	probably damaging	Het
Pcgf5	T	A	19: 36,437,183	F80I	probably damaging	Het
Pkhd1	T	G	1: 20,547,341	S1007R	probably benign	Het
Rab30	T	C	7: 92,835,913	Y196H	probably benign	Het
Setd2	A	T	9: 110,551,230	D1371V	probably damaging	Het
Slc48a1	A	T	15: 97,790,700	I140F	possibly damaging	Het
Sorl1	A	G	9: 42,033,583	V882A	probably benign	Het
Sptbn2	G	T	19: 4,724,184	G88W	probably damaging	Het
Tdrd12	A	G	7: 35,490,030	V427A	possibly damaging	Het
Tekt2	T	C	4: 126,324,670	D69G	probably benign	Het
Tie1	C	T	4: 118,480,510	V463I	probably benign	Het
Tmem150c	G	T	5: 100,079,954	H217N	probably damaging	Het
Tnks2	G	A	19: 36,888,852	G1080R	probably damaging	Het
Ttll4	G	A	1: 74,687,852		probably null	Het

Other mutations in Adam7

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00667:Adam7	APN	14	68521938	missense	possibly damaging	0.68
IGL01418:Adam7	APN	14	68525206	missense	probably benign
IGL01934:Adam7	APN	14	68532599	missense	probably damaging	1.00
IGL02655:Adam7	APN	14	68516611	missense	probably damaging	1.00
IGL02669:Adam7	APN	14	68507894	missense	probably damaging	1.00
PIT4445001:Adam7	UTSW	14	68509748	missense	possibly damaging	0.88
R0195:Adam7	UTSW	14	68527627	splice site	probably benign
R0277:Adam7	UTSW	14	68510857	splice site	probably null
R0362:Adam7	UTSW	14	68509656	splice site	probably benign
R0440:Adam7	UTSW	14	68510856	splice site	probably null
R0927:Adam7	UTSW	14	68516684	missense	probably damaging	1.00
R1172:Adam7	UTSW	14	68514921	missense	probably damaging	1.00
R1270:Adam7	UTSW	14	68527669	missense	probably damaging	0.98
R1299:Adam7	UTSW	14	68526299	splice site	probably benign
R1527:Adam7	UTSW	14	68501521	missense	probably benign	0.04
R1543:Adam7	UTSW	14	68521922	splice site	probably benign
R1731:Adam7	UTSW	14	68525356	missense	probably damaging	1.00
R1732:Adam7	UTSW	14	68498450	missense	probably benign	0.00
R1921:Adam7	UTSW	14	68512625	missense	possibly damaging	0.55
R2062:Adam7	UTSW	14	68505161	missense	probably benign	0.09
R2156:Adam7	UTSW	14	68511343	missense	probably benign	0.02
R2353:Adam7	UTSW	14	68505088	missense	probably benign	0.01
R2697:Adam7	UTSW	14	68514783	nonsense	probably null
R4080:Adam7	UTSW	14	68520539	missense	probably benign	0.05
R4775:Adam7	UTSW	14	68507912	missense	probably benign	0.41
R6006:Adam7	UTSW	14	68511396	missense	probably damaging	1.00
R6087:Adam7	UTSW	14	68510757	missense	probably damaging	1.00
R6376:Adam7	UTSW	14	68505097	missense	possibly damaging	0.78
R6417:Adam7	UTSW	14	68504621	missense	probably benign	0.37
R6672:Adam7	UTSW	14	68504702	critical splice acceptor site	probably null
R6756:Adam7	UTSW	14	68525279	missense	probably benign	0.00
R6777:Adam7	UTSW	14	68525335	missense	probably damaging	1.00
R6913:Adam7	UTSW	14	68533651	missense	probably benign	0.22
R7127:Adam7	UTSW	14	68514769	critical splice donor site	probably null
R7209:Adam7	UTSW	14	68529819	missense	probably damaging	1.00
R7399:Adam7	UTSW	14	68504466	splice site	probably null
R7675:Adam7	UTSW	14	68499853	missense	probably benign	0.07
R7788:Adam7	UTSW	14	68512645	missense	possibly damaging	0.62
R7868:Adam7	UTSW	14	68532641	missense	possibly damaging	0.84
R8135:Adam7	UTSW	14	68516573	missense	probably damaging	1.00
R8281:Adam7	UTSW	14	68507885	missense	possibly damaging	0.65
R8507:Adam7	UTSW	14	68526324	missense	probably damaging	1.00
R9049:Adam7	UTSW	14	68525225	missense	probably benign	0.01
R9240:Adam7	UTSW	14	68509759	missense	probably benign	0.02
R9429:Adam7	UTSW	14	68533631	missense	probably null
R9744:Adam7	UTSW	14	68505134	missense	probably benign	0.00
Z1176:Adam7	UTSW	14	68527701	missense	probably benign	0.26

Predicted Primers

PCR Primer
(F):5'- GACTTTTGGGATAGCATTGGAAATG -3'
(R):5'- GTCTCTGTTGTGGAAGCAACC -3'

Sequencing Primer
(F):5'- TTGGGATAGCATTGGAAATGTAAATG -3'
(R):5'- GGAAGCAACCTGTCCTAGTATTGC -3'

Posted On

2017-05-25