Incidental Mutation 'LCD18:Gls'
ID478146
Institutional Source Beutler Lab
Gene Symbol Gls
Ensembl Gene ENSMUSG00000026103
Gene Nameglutaminase
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #LCD18 (G1)
Quality Score999
Status Validated
Chromosome1
Chromosomal Location52163448-52233232 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to G at 52183367 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000114510] [ENSMUST00000114512] [ENSMUST00000114513] [ENSMUST00000155587]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000114509
SMART Domains Protein: ENSMUSP00000110154
Gene: ENSMUSG00000026103

DomainStartEndE-ValueType
Pfam:Glutaminase 18 208 2.9e-79 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114510
SMART Domains Protein: ENSMUSP00000110155
Gene: ENSMUSG00000026103

DomainStartEndE-ValueType
low complexity region 56 77 N/A INTRINSIC
low complexity region 89 110 N/A INTRINSIC
Pfam:Glutaminase 249 535 3e-127 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114512
SMART Domains Protein: ENSMUSP00000110157
Gene: ENSMUSG00000026103

DomainStartEndE-ValueType
Pfam:Glutaminase 66 352 1.7e-125 PFAM
ANK 407 437 3.9e-6 SMART
ANK 441 470 3.6e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114513
SMART Domains Protein: ENSMUSP00000110158
Gene: ENSMUSG00000026103

DomainStartEndE-ValueType
low complexity region 56 77 N/A INTRINSIC
low complexity region 89 110 N/A INTRINSIC
Pfam:Glutaminase 249 535 4.2e-123 PFAM
ANK 590 620 6.02e-4 SMART
ANK 624 653 5.69e2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129107
SMART Domains Protein: ENSMUSP00000121408
Gene: ENSMUSG00000026103

DomainStartEndE-ValueType
Pfam:Glutaminase 5 66 1e-26 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138906
Predicted Effect probably benign
Transcript: ENSMUST00000155587
SMART Domains Protein: ENSMUSP00000115358
Gene: ENSMUSG00000026103

DomainStartEndE-ValueType
Pfam:Glutaminase 1 206 2.4e-92 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156887
SMART Domains Protein: ENSMUSP00000116901
Gene: ENSMUSG00000026103

DomainStartEndE-ValueType
Pfam:Glutaminase 5 66 3.1e-26 PFAM
ANK 121 151 6.02e-4 SMART
ANK 155 184 5.69e2 SMART
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 88% (169/191)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the K-type mitochondrial glutaminase. The encoded protein is an phosphate-activated amidohydrolase that catalyzes the hydrolysis of glutamine to glutamate and ammonia. This protein is primarily expressed in the brain and kidney plays an essential role in generating energy for metabolism, synthesizing the brain neurotransmitter glutamate and maintaining acid-base balance in the kidney. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jan 2012]
PHENOTYPE: Homozygotes for targeted null mutations die within 1 day postnatally with abnormal respiratory function and goal-oriented behavior toward dam. Mice homozygous for another allele exhibit abnormal TNFA-stimulated astrocyte extracellular vesicle release. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 113 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007G11Rik G A 5: 98,707,508 probably benign Het
4930548H24Rik GAGAAG GAG 5: 31,487,373 probably benign Het
9530077C05Rik N 9: 22,442,083 probably benign Het
A330008L17Rik A G 8: 99,723,425 noncoding transcript Het
Aaed1 G A 13: 64,287,285 probably benign Het
Aff2 C A X: 69,747,535 probably benign Het
Aldh1a1 C A 19: 20,626,646 probably benign Het
Anxa7 C T 14: 20,469,411 G113E probably damaging Het
Apba2 A T 7: 64,622,160 probably benign Het
Apc2 G C 10: 80,299,974 probably benign Het
App C G 16: 85,025,412 probably benign Het
Asic2 C A 11: 80,985,744 probably benign Het
Btk T C X: 134,578,825 probably benign Het
C530008M17Rik GGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTG GGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTG 5: 76,658,742 probably benign Het
Car12 C A 9: 66,761,676 probably benign Het
Ccdc191 G A 16: 43,921,801 probably benign Het
Ccdc34 N 2: 110,016,318 probably benign Het
Cd164 G T 10: 41,521,926 A59S probably benign Het
Cd22 C T 7: 30,878,082 R2H possibly damaging Het
Cdv3 A T 9: 103,365,343 probably benign Het
Cdv3 C A 9: 103,365,354 probably benign Het
Celf2 N 2: 6,779,076 probably benign Het
Clec18a C A 8: 111,076,136 probably benign Het
Cnpy3 GGATGGAT GGATAGATAGATAGATAGATGGAT 17: 46,737,536 probably benign Het
Cntn4 A G 6: 106,553,940 probably benign Het
Cntnap5c G C 17: 58,162,160 probably benign Het
Col2a1 C A 15: 97,988,981 probably null Het
Cpne3 G T 4: 19,563,382 probably benign Het
Dab1 T G 4: 104,046,572 probably benign Het
Dapp1 G A 3: 137,939,400 probably benign Het
Dcc G A 18: 72,297,447 probably benign Het
Dcun1d1 GAAAAAAAAA GAAAAAAAAAA 3: 35,938,005 probably benign Het
Dennd1b G A 1: 139,114,764 probably benign Het
Dhdds TAA TA 4: 133,970,363 probably benign Het
Dnah12 G T 14: 26,849,385 G2817V probably damaging Het
Dnm3 CATATATATATATATATATATATA CATATATATATATATATATATA 1: 162,406,561 probably benign Het
Dock10 N 1: 80,716,623 probably benign Het
Dusp10 G T 1: 184,037,056 C73F probably damaging Het
Fgf20 A C 8: 40,292,318 probably benign Het
Ftsj3 G T 11: 106,250,059 probably benign Het
Gm12130 T C 11: 38,506,923 noncoding transcript Het
Gm12394 T C 4: 42,792,885 T416A probably benign Het
Gm14936 G A X: 112,998,750 noncoding transcript Het
Gm16630 C T 6: 48,141,269 noncoding transcript Het
Gm22194 AGTGTGTGTGTGTGTGTGTGTGTGTGTGTG AGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTG 10: 11,940,963 noncoding transcript Het
Gm26917 C G 17: 39,843,971 noncoding transcript Het
Gm35048 GACACACACACACACACACACACACACACACACACACAC GACACACACACACACACACACACACACACACACACAC 1: 90,521,526 noncoding transcript Het
Gm37311 G A 16: 77,618,281 noncoding transcript Het
Gm37928 AACACACACACACACACACACACACACACACACA AACACACACACACACACACACACACACACACACACA 3: 118,534,557 noncoding transcript Het
Gm42418 T C 17: 39,848,555 noncoding transcript Het
Gm4302 T C 10: 100,341,444 W197R probably benign Het
Gm5615 T C 9: 36,533,553 probably benign Het
H2-Q4 G A 17: 35,380,405 D155N probably damaging Het
H2-T23 T C 17: 36,031,216 probably benign Het
Hgs CTTTTTTT CTTTTTT 11: 120,469,578 probably benign Het
Ighv5-9 C T 12: 113,661,877 S82N probably benign Het
Il1rap C A 16: 26,631,593 probably benign Het
Inhbc N 10: 127,367,140 probably benign Het
Inpp4b C T 8: 81,693,010 probably benign Het
Kars N 8: 111,993,708 probably benign Het
Kcng4 G T 8: 119,633,519 Y39* probably null Het
Kcnh7 A G 2: 63,049,799 probably benign Het
Klhl1 G C 14: 96,317,730 probably benign Het
Lrch1 C T 14: 74,905,021 probably benign Het
Lrp1b G C 2: 42,237,562 probably benign Het
Lsm8 G A 6: 18,844,316 probably benign Het
Lsm8 G A 6: 18,854,321 probably benign Het
Magi2 T C 5: 19,954,511 probably benign Het
Marc2 TAGGCAGCCAATCAGAGCACTGCCTCTCAGCGCCAGGCAGCCAATCAGAGCACTGCCTCTCAGCGCCAGGCA TAGGCAGCCAATCAGAGCACTGCCTCTCAGCGCCAGGCA 1: 184,822,788 probably benign Het
Mef2c G A 13: 83,605,823 probably benign Het
Mei4 A G 9: 82,186,959 probably benign Het
Mid1 T A X: 170,005,564 probably benign Het
Mndal G C 1: 173,880,218 probably benign Het
Mpped2 C A 2: 106,721,428 probably benign Het
Mtf1 A G 4: 124,829,316 probably benign Het
Mxd1 T C 6: 86,667,406 probably benign Het
Nbea G T 3: 55,701,527 probably benign Het
Ncor1 N 11: 62,419,782 probably benign Het
Nox4 A G 7: 87,243,067 probably benign Het
Ocln C T 13: 100,520,567 probably benign Het
Ofcc1 G A 13: 40,092,967 probably benign Het
Olfr313 T A 11: 58,817,440 V144D possibly damaging Het
Paics N 5: 76,956,744 probably null Het
Paqr8 G T 1: 20,914,658 probably benign Het
Pdss1 C T 2: 22,900,968 probably benign Het
Piezo1 G A 8: 122,495,569 R503W probably damaging Het
Pkhd1 G A 1: 20,611,414 probably benign Het
Ppp1r3f C A X: 7,560,336 G562V probably damaging Het
Prr16 C T 18: 51,200,324 probably benign Het
Prss38 T G 11: 59,375,641 probably benign Het
Ptprk T C 10: 28,574,987 probably benign Het
Pum1 N 4: 130,730,549 probably benign Het
Rabgef1 N 5: 130,187,586 probably null Het
Rgs16 G A 1: 153,744,230 probably benign Het
Riok3 G T 18: 12,129,982 probably benign Het
Robo2 N 16: 74,055,954 probably benign Het
Rps6ka3 A G X: 159,279,215 probably benign Het
Rptn T A 3: 93,397,541 L727Q probably benign Het
Slc25a46 C A 18: 31,597,313 probably benign Het
Spsb1 C T 4: 149,952,486 probably benign Het
Tbc1d19 A C 5: 53,816,709 probably benign Het
Trav7-4 C T 14: 53,461,518 L41F probably benign Het
Trip12 N 1: 84,754,482 probably benign Het
Ttc13 G A 8: 124,675,866 probably benign Het
Ttll6 C T 11: 96,155,258 probably benign Het
Unc5b C G 10: 60,786,171 probably benign Het
Vmn2r87 C T 10: 130,478,714 M334I probably benign Het
Vps13b G T 15: 35,846,957 A2629S probably damaging Het
Wars2 N 3: 99,214,774 probably null Het
Zdhhc3 AACACACACACACACACACACACACACACACAC AACACACACACACACACACACACACACACACACAC 9: 123,083,022 probably benign Het
Zfp26 C A 9: 20,438,546 A241S probably benign Het
Zfp442 C T 2: 150,419,848 probably benign Het
Zfp808 C T 13: 62,166,651 probably benign Het
Other mutations in Gls
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01339:Gls APN 1 52188708 missense probably damaging 1.00
IGL01366:Gls APN 1 52168399 missense probably damaging 1.00
IGL01367:Gls APN 1 52168399 missense probably damaging 1.00
IGL01832:Gls APN 1 52168409 splice site probably null
IGL02045:Gls APN 1 52219515 missense probably benign 0.01
R0268:Gls UTSW 1 52232694 small deletion probably benign
R0373:Gls UTSW 1 52188699 missense probably damaging 1.00
R0590:Gls UTSW 1 52212375 unclassified probably benign
R1440:Gls UTSW 1 52191134 missense possibly damaging 0.59
R1628:Gls UTSW 1 52232676 missense probably benign 0.06
R3684:Gls UTSW 1 52166293 missense probably damaging 1.00
R3697:Gls UTSW 1 52199764 missense possibly damaging 0.65
R3778:Gls UTSW 1 52168912 missense probably benign 0.05
R3824:Gls UTSW 1 52232988 missense possibly damaging 0.83
R4062:Gls UTSW 1 52196748 missense probably damaging 1.00
R4441:Gls UTSW 1 52196163 critical splice donor site probably null
R4740:Gls UTSW 1 52232788 missense probably damaging 0.99
R4816:Gls UTSW 1 52199945 intron probably benign
R5281:Gls UTSW 1 52191157 missense probably damaging 1.00
R5712:Gls UTSW 1 52196752 missense probably damaging 1.00
R6163:Gls UTSW 1 52215576 missense probably benign 0.00
R6357:Gls UTSW 1 52219506 missense probably damaging 0.99
R6498:Gls UTSW 1 52220039 missense probably benign
R7187:Gls UTSW 1 52219980 missense probably damaging 1.00
R7413:Gls UTSW 1 52215576 missense probably benign 0.00
R7545:Gls UTSW 1 52191152 missense probably damaging 1.00
R7627:Gls UTSW 1 52166266 missense probably benign 0.00
R7648:Gls UTSW 1 52196780 missense probably damaging 0.99
R7781:Gls UTSW 1 52212333 nonsense probably null
Z1176:Gls UTSW 1 52214488 missense not run
Predicted Primers PCR Primer
(F):5'- ATAGGATTAATGCCAGAACTAGCAG -3'
(R):5'- TGCTACAGATGTCAAACCTTTTCC -3'

Sequencing Primer
(F):5'- GACACAGGGTTCAATCTATGGCTTC -3'
(R):5'- CCTACATTTTGTTTGTATCTTAGTGC -3'
Posted On2017-05-26