Incidental Mutation 'LCD18:Kcnh7'
ID478155
Institutional Source Beutler Lab
Gene Symbol Kcnh7
Ensembl Gene ENSMUSG00000059742
Gene Namepotassium voltage-gated channel, subfamily H (eag-related), member 7
SynonymsKv11.3, 9330137I11Rik, erg3
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.101) question?
Stock #LCD18 (G1)
Quality Score999
Status Validated
Chromosome2
Chromosomal Location62693414-63184287 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to G at 63049799 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000108073 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075052] [ENSMUST00000112452] [ENSMUST00000112454]
Predicted Effect probably benign
Transcript: ENSMUST00000075052
SMART Domains Protein: ENSMUSP00000074563
Gene: ENSMUSG00000059742

DomainStartEndE-ValueType
PAS 20 87 8.97e0 SMART
PAC 93 135 3.48e-1 SMART
Pfam:Ion_trans 407 674 4.9e-39 PFAM
Pfam:Ion_trans_2 588 668 3.2e-13 PFAM
cNMP 745 863 1.5e-23 SMART
low complexity region 921 940 N/A INTRINSIC
coiled coil region 1022 1058 N/A INTRINSIC
low complexity region 1114 1127 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112452
SMART Domains Protein: ENSMUSP00000108071
Gene: ENSMUSG00000059742

DomainStartEndE-ValueType
PAS 20 87 8.97e0 SMART
PAC 93 135 3.48e-1 SMART
Blast:MYSc 309 426 4e-24 BLAST
low complexity region 446 461 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112454
SMART Domains Protein: ENSMUSP00000108073
Gene: ENSMUSG00000059742

DomainStartEndE-ValueType
PAS 20 87 8.97e0 SMART
PAC 93 135 3.48e-1 SMART
Blast:MYSc 316 433 3e-24 BLAST
low complexity region 453 468 N/A INTRINSIC
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 88% (169/191)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. This gene encodes a member of the potassium channel, voltage-gated, subfamily H. This member is a pore-forming (alpha) subunit. There are at least two alternatively spliced transcript variants derived from this gene and encoding distinct isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 113 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007G11Rik G A 5: 98,707,508 probably benign Het
4930548H24Rik GAGAAG GAG 5: 31,487,373 probably benign Het
9530077C05Rik N 9: 22,442,083 probably benign Het
A330008L17Rik A G 8: 99,723,425 noncoding transcript Het
Aaed1 G A 13: 64,287,285 probably benign Het
Aff2 C A X: 69,747,535 probably benign Het
Aldh1a1 C A 19: 20,626,646 probably benign Het
Anxa7 C T 14: 20,469,411 G113E probably damaging Het
Apba2 A T 7: 64,622,160 probably benign Het
Apc2 G C 10: 80,299,974 probably benign Het
App C G 16: 85,025,412 probably benign Het
Asic2 C A 11: 80,985,744 probably benign Het
Btk T C X: 134,578,825 probably benign Het
C530008M17Rik GGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTG GGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTG 5: 76,658,742 probably benign Het
Car12 C A 9: 66,761,676 probably benign Het
Ccdc191 G A 16: 43,921,801 probably benign Het
Ccdc34 N 2: 110,016,318 probably benign Het
Cd164 G T 10: 41,521,926 A59S probably benign Het
Cd22 C T 7: 30,878,082 R2H possibly damaging Het
Cdv3 A T 9: 103,365,343 probably benign Het
Cdv3 C A 9: 103,365,354 probably benign Het
Celf2 N 2: 6,779,076 probably benign Het
Clec18a C A 8: 111,076,136 probably benign Het
Cnpy3 GGATGGAT GGATAGATAGATAGATAGATGGAT 17: 46,737,536 probably benign Het
Cntn4 A G 6: 106,553,940 probably benign Het
Cntnap5c G C 17: 58,162,160 probably benign Het
Col2a1 C A 15: 97,988,981 probably null Het
Cpne3 G T 4: 19,563,382 probably benign Het
Dab1 T G 4: 104,046,572 probably benign Het
Dapp1 G A 3: 137,939,400 probably benign Het
Dcc G A 18: 72,297,447 probably benign Het
Dcun1d1 GAAAAAAAAA GAAAAAAAAAA 3: 35,938,005 probably benign Het
Dennd1b G A 1: 139,114,764 probably benign Het
Dhdds TAA TA 4: 133,970,363 probably benign Het
Dnah12 G T 14: 26,849,385 G2817V probably damaging Het
Dnm3 CATATATATATATATATATATATA CATATATATATATATATATATA 1: 162,406,561 probably benign Het
Dock10 N 1: 80,716,623 probably benign Het
Dusp10 G T 1: 184,037,056 C73F probably damaging Het
Fgf20 A C 8: 40,292,318 probably benign Het
Ftsj3 G T 11: 106,250,059 probably benign Het
Gls T G 1: 52,183,367 probably benign Het
Gm12130 T C 11: 38,506,923 noncoding transcript Het
Gm12394 T C 4: 42,792,885 T416A probably benign Het
Gm14936 G A X: 112,998,750 noncoding transcript Het
Gm16630 C T 6: 48,141,269 noncoding transcript Het
Gm22194 AGTGTGTGTGTGTGTGTGTGTGTGTGTGTG AGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTG 10: 11,940,963 noncoding transcript Het
Gm26917 C G 17: 39,843,971 noncoding transcript Het
Gm35048 GACACACACACACACACACACACACACACACACACACAC GACACACACACACACACACACACACACACACACACAC 1: 90,521,526 noncoding transcript Het
Gm37311 G A 16: 77,618,281 noncoding transcript Het
Gm37928 AACACACACACACACACACACACACACACACACA AACACACACACACACACACACACACACACACACACA 3: 118,534,557 noncoding transcript Het
Gm42418 T C 17: 39,848,555 noncoding transcript Het
Gm4302 T C 10: 100,341,444 W197R probably benign Het
Gm5615 T C 9: 36,533,553 probably benign Het
H2-Q4 G A 17: 35,380,405 D155N probably damaging Het
H2-T23 T C 17: 36,031,216 probably benign Het
Hgs CTTTTTTT CTTTTTT 11: 120,469,578 probably benign Het
Ighv5-9 C T 12: 113,661,877 S82N probably benign Het
Il1rap C A 16: 26,631,593 probably benign Het
Inhbc N 10: 127,367,140 probably benign Het
Inpp4b C T 8: 81,693,010 probably benign Het
Kars N 8: 111,993,708 probably benign Het
Kcng4 G T 8: 119,633,519 Y39* probably null Het
Klhl1 G C 14: 96,317,730 probably benign Het
Lrch1 C T 14: 74,905,021 probably benign Het
Lrp1b G C 2: 42,237,562 probably benign Het
Lsm8 G A 6: 18,844,316 probably benign Het
Lsm8 G A 6: 18,854,321 probably benign Het
Magi2 T C 5: 19,954,511 probably benign Het
Marc2 TAGGCAGCCAATCAGAGCACTGCCTCTCAGCGCCAGGCAGCCAATCAGAGCACTGCCTCTCAGCGCCAGGCA TAGGCAGCCAATCAGAGCACTGCCTCTCAGCGCCAGGCA 1: 184,822,788 probably benign Het
Mef2c G A 13: 83,605,823 probably benign Het
Mei4 A G 9: 82,186,959 probably benign Het
Mid1 T A X: 170,005,564 probably benign Het
Mndal G C 1: 173,880,218 probably benign Het
Mpped2 C A 2: 106,721,428 probably benign Het
Mtf1 A G 4: 124,829,316 probably benign Het
Mxd1 T C 6: 86,667,406 probably benign Het
Nbea G T 3: 55,701,527 probably benign Het
Ncor1 N 11: 62,419,782 probably benign Het
Nox4 A G 7: 87,243,067 probably benign Het
Ocln C T 13: 100,520,567 probably benign Het
Ofcc1 G A 13: 40,092,967 probably benign Het
Olfr313 T A 11: 58,817,440 V144D possibly damaging Het
Paics N 5: 76,956,744 probably null Het
Paqr8 G T 1: 20,914,658 probably benign Het
Pdss1 C T 2: 22,900,968 probably benign Het
Piezo1 G A 8: 122,495,569 R503W probably damaging Het
Pkhd1 G A 1: 20,611,414 probably benign Het
Ppp1r3f C A X: 7,560,336 G562V probably damaging Het
Prr16 C T 18: 51,200,324 probably benign Het
Prss38 T G 11: 59,375,641 probably benign Het
Ptprk T C 10: 28,574,987 probably benign Het
Pum1 N 4: 130,730,549 probably benign Het
Rabgef1 N 5: 130,187,586 probably null Het
Rgs16 G A 1: 153,744,230 probably benign Het
Riok3 G T 18: 12,129,982 probably benign Het
Robo2 N 16: 74,055,954 probably benign Het
Rps6ka3 A G X: 159,279,215 probably benign Het
Rptn T A 3: 93,397,541 L727Q probably benign Het
Slc25a46 C A 18: 31,597,313 probably benign Het
Spsb1 C T 4: 149,952,486 probably benign Het
Tbc1d19 A C 5: 53,816,709 probably benign Het
Trav7-4 C T 14: 53,461,518 L41F probably benign Het
Trip12 N 1: 84,754,482 probably benign Het
Ttc13 G A 8: 124,675,866 probably benign Het
Ttll6 C T 11: 96,155,258 probably benign Het
Unc5b C G 10: 60,786,171 probably benign Het
Vmn2r87 C T 10: 130,478,714 M334I probably benign Het
Vps13b G T 15: 35,846,957 A2629S probably damaging Het
Wars2 N 3: 99,214,774 probably null Het
Zdhhc3 AACACACACACACACACACACACACACACACAC AACACACACACACACACACACACACACACACACAC 9: 123,083,022 probably benign Het
Zfp26 C A 9: 20,438,546 A241S probably benign Het
Zfp442 C T 2: 150,419,848 probably benign Het
Zfp808 C T 13: 62,166,651 probably benign Het
Other mutations in Kcnh7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00513:Kcnh7 APN 2 62764691 missense probably benign 0.01
IGL00693:Kcnh7 APN 2 62734254 missense probably benign 0.06
IGL00776:Kcnh7 APN 2 62850376 missense probably benign 0.00
IGL00956:Kcnh7 APN 2 62777639 missense probably damaging 1.00
IGL01651:Kcnh7 APN 2 62734284 missense possibly damaging 0.47
IGL01780:Kcnh7 APN 2 62837163 missense probably benign 0.17
IGL01859:Kcnh7 APN 2 62721788 missense probably benign 0.00
IGL02213:Kcnh7 APN 2 62739362 missense probably damaging 1.00
IGL02302:Kcnh7 APN 2 62706058 missense probably damaging 1.00
IGL02526:Kcnh7 APN 2 62850437 missense possibly damaging 0.46
IGL02850:Kcnh7 APN 2 62787685 nonsense probably null
IGL02989:Kcnh7 APN 2 62721925 missense probably benign
IGL02990:Kcnh7 APN 2 62705986 missense probably benign 0.11
R0129:Kcnh7 UTSW 2 62716159 missense probably benign 0.00
R0622:Kcnh7 UTSW 2 62837289 splice site probably null
R0638:Kcnh7 UTSW 2 62777510 missense probably benign 0.13
R1006:Kcnh7 UTSW 2 62716183 missense probably benign 0.00
R1200:Kcnh7 UTSW 2 62777395 missense probably damaging 1.00
R1330:Kcnh7 UTSW 2 62777411 missense possibly damaging 0.56
R1614:Kcnh7 UTSW 2 62850604 missense probably benign 0.03
R1782:Kcnh7 UTSW 2 62736169 missense probably damaging 1.00
R1861:Kcnh7 UTSW 2 62777392 missense probably damaging 0.97
R1862:Kcnh7 UTSW 2 62787754 missense possibly damaging 0.46
R2197:Kcnh7 UTSW 2 62777606 missense probably damaging 1.00
R2510:Kcnh7 UTSW 2 62721917 missense probably benign
R2988:Kcnh7 UTSW 2 62721828 missense probably benign 0.20
R3024:Kcnh7 UTSW 2 62764663 missense probably damaging 1.00
R3433:Kcnh7 UTSW 2 62721917 missense probably benign
R4415:Kcnh7 UTSW 2 62706073 missense probably damaging 1.00
R4540:Kcnh7 UTSW 2 62739186 missense probably damaging 1.00
R4570:Kcnh7 UTSW 2 62837095 missense possibly damaging 0.91
R4827:Kcnh7 UTSW 2 62716220 missense probably benign
R4990:Kcnh7 UTSW 2 62734288 missense probably benign 0.00
R5172:Kcnh7 UTSW 2 62739164 missense possibly damaging 0.88
R5822:Kcnh7 UTSW 2 62716238 missense probably benign
R5996:Kcnh7 UTSW 2 63184097 start gained probably benign
R6142:Kcnh7 UTSW 2 62739360 missense possibly damaging 0.95
R6226:Kcnh7 UTSW 2 62777559 missense probably damaging 1.00
R6244:Kcnh7 UTSW 2 63182226 missense probably damaging 1.00
R6304:Kcnh7 UTSW 2 62764616 nonsense probably null
R6400:Kcnh7 UTSW 2 62739344 missense probably damaging 1.00
R6430:Kcnh7 UTSW 2 62850532 missense probably benign 0.04
R6483:Kcnh7 UTSW 2 62845774 missense probably benign 0.06
R6614:Kcnh7 UTSW 2 62777596 missense probably damaging 1.00
R6753:Kcnh7 UTSW 2 62850377 missense probably benign
R6822:Kcnh7 UTSW 2 62787904 missense probably damaging 1.00
R6863:Kcnh7 UTSW 2 62787685 missense possibly damaging 0.83
R7104:Kcnh7 UTSW 2 62787687 missense possibly damaging 0.82
R7116:Kcnh7 UTSW 2 62877270 missense probably benign 0.02
R7263:Kcnh7 UTSW 2 62735970 splice site probably null
R7657:Kcnh7 UTSW 2 62736035 missense probably damaging 1.00
R7855:Kcnh7 UTSW 2 62837194 nonsense probably null
R7938:Kcnh7 UTSW 2 62837194 nonsense probably null
X0011:Kcnh7 UTSW 2 62764723 missense probably damaging 0.99
Z1088:Kcnh7 UTSW 2 62736103 missense probably damaging 1.00
Z1088:Kcnh7 UTSW 2 63184068 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTATCCTGTAAGCCCTTTACTAGG -3'
(R):5'- AAAGTTGCGTGCACAGCAG -3'

Sequencing Primer
(F):5'- AACTTACCGAGAGGACGT -3'
(R):5'- ATGCTAACACAGCCAGTC -3'
Posted On2017-05-26