Incidental Mutation 'R0510:Fat3'
ID47818
Institutional Source Beutler Lab
Gene Symbol Fat3
Ensembl Gene ENSMUSG00000074505
Gene NameFAT atypical cadherin 3
Synonyms9430076A06Rik, D430038H04Rik, LOC382129, LOC234973
MMRRC Submission 038704-MU
Accession Numbers

Genbank: NM_001080814; MGI: 2444314

Is this an essential gene? Possibly essential (E-score: 0.528) question?
Stock #R0510 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location15910189-16501285 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 15999685 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 1674 (E1674*)
Ref Sequence ENSEMBL: ENSMUSP00000148968 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082170] [ENSMUST00000217308]
Predicted Effect probably null
Transcript: ENSMUST00000082170
AA Change: E1674*
SMART Domains Protein: ENSMUSP00000080808
Gene: ENSMUSG00000074505
AA Change: E1674*

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
CA 65 151 3e-7 SMART
CA 175 259 8.9e-22 SMART
CA 280 368 8.9e-4 SMART
CA 389 465 2.6e-11 SMART
CA 489 571 2e-29 SMART
low complexity region 684 697 N/A INTRINSIC
CA 743 824 1e-24 SMART
low complexity region 830 840 N/A INTRINSIC
CA 848 929 7.6e-26 SMART
CA 953 1034 1.5e-25 SMART
CA 1060 1141 6.6e-32 SMART
CA 1165 1247 1.5e-30 SMART
CA 1273 1349 1.8e-8 SMART
CA 1375 1453 2.9e-12 SMART
CA 1477 1559 3e-22 SMART
CA 1583 1664 3.1e-16 SMART
CA 1688 1762 4.2e-22 SMART
CA 1793 1876 2.5e-26 SMART
CA 1900 1975 1.5e-8 SMART
low complexity region 1983 1994 N/A INTRINSIC
CA 1999 2077 1.4e-18 SMART
CA 2101 2179 6.6e-10 SMART
CA 2203 2280 4.9e-19 SMART
CA 2304 2387 4.3e-29 SMART
CA 2411 2489 4.2e-11 SMART
CA 2513 2593 2.8e-22 SMART
CA 2617 2701 4.3e-10 SMART
CA 2719 2807 2.5e-7 SMART
CA 2831 2917 3.3e-27 SMART
CA 2941 3022 9.4e-23 SMART
CA 3046 3124 2.4e-26 SMART
CA 3148 3229 1.3e-32 SMART
CA 3253 3334 1.3e-29 SMART
CA 3358 3439 4.9e-28 SMART
CA 3463 3544 6.4e-12 SMART
EGF 3793 3828 1.3e-1 SMART
LamG 3852 3989 4.3e-25 SMART
EGF 4019 4053 2.7e-6 SMART
EGF 4058 4091 4.5e-6 SMART
EGF_CA 4093 4129 3.9e-11 SMART
transmembrane domain 4151 4170 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000217308
AA Change: E1674*
Meta Mutation Damage Score 0.9754 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.2%
Validation Efficiency 99% (102/103)
MGI Phenotype PHENOTYPE: Mice homozgyous for a knock-out allele exhibit abnormal amacrine cell differentiation and migration that result in the formation of two additional plexiform layers and thickened retinal ganglion layer. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Gene trapped(3)

Other mutations in this stock
Total: 101 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933408B17Rik A T 18: 34,596,151 D42E probably damaging Het
Abcg3 A G 5: 104,977,616 I67T probably damaging Het
Acoxl G A 2: 127,880,503 probably null Het
Adam10 T A 9: 70,748,248 W333R probably damaging Het
Ahnak C T 19: 9,018,232 R5627* probably null Het
Alms1 A T 6: 85,620,369 R1195* probably null Het
Ap2m1 T A 16: 20,542,240 I334N possibly damaging Het
Camta1 C A 4: 151,075,140 R1614L probably damaging Het
Ccdc110 T A 8: 45,935,157 N50K probably benign Het
Cdhr1 T C 14: 37,080,676 Y610C probably damaging Het
Cdkal1 C A 13: 29,691,596 probably null Het
Celsr3 G A 9: 108,827,005 C229Y possibly damaging Het
Clca4b A T 3: 144,913,351 Y676N probably damaging Het
Col11a1 A T 3: 114,105,456 probably benign Het
Cpe T A 8: 64,611,467 I233F probably damaging Het
Cpsf1 A T 15: 76,603,657 probably benign Het
Cpsf2 T C 12: 101,988,786 V272A probably damaging Het
Creld2 A T 15: 88,819,956 N50I probably damaging Het
Cyb5r1 T C 1: 134,409,692 probably benign Het
Dcaf11 T C 14: 55,569,080 V446A probably damaging Het
Defa34 A G 8: 21,665,972 probably null Het
Dgat1 T C 15: 76,511,567 Y72C possibly damaging Het
Efr3b G T 12: 3,982,058 D183E probably benign Het
Enpp3 A T 10: 24,776,781 D759E probably damaging Het
Epyc A G 10: 97,649,763 T22A probably benign Het
Etfbkmt C T 6: 149,150,584 R96W probably benign Het
Fam83b G T 9: 76,492,826 L332I possibly damaging Het
Fbn1 A G 2: 125,342,925 probably benign Het
Gm5134 C A 10: 75,974,245 T120N probably benign Het
Gm5415 T A 1: 32,545,875 N318I possibly damaging Het
Gm8251 T A 1: 44,061,097 K280N possibly damaging Het
Gmip C T 8: 69,815,609 probably benign Het
Gpbp1 G T 13: 111,440,745 Q204K possibly damaging Het
Gpr108 T C 17: 57,235,358 D549G possibly damaging Het
Gsdme C A 6: 50,246,127 probably benign Het
Gucy2e T C 11: 69,235,576 D326G probably benign Het
H2-Eb2 C T 17: 34,334,244 Q135* probably null Het
Hectd4 T A 5: 121,281,896 Y635N possibly damaging Het
Hectd4 G A 5: 121,305,673 E1319K possibly damaging Het
Hs3st2 T C 7: 121,500,569 S213P probably damaging Het
Ikbkb A T 8: 22,671,635 C412* probably null Het
Itpr2 T C 6: 146,417,979 T188A possibly damaging Het
Kcnh1 T A 1: 192,418,941 probably benign Het
Kctd21 T C 7: 97,347,541 F74L probably damaging Het
Krt23 T A 11: 99,486,782 I133L probably damaging Het
Krt74 T C 15: 101,763,316 noncoding transcript Het
Krt81 C A 15: 101,463,627 R24L possibly damaging Het
Lmtk3 T A 7: 45,794,112 L740M possibly damaging Het
Lrrc10 T A 10: 117,045,790 L123Q probably damaging Het
Map1a A T 2: 121,305,774 H2357L probably benign Het
Mbl1 A G 14: 41,158,749 N198S probably damaging Het
Mcf2l A G 8: 12,997,337 D233G probably damaging Het
Msto1 A G 3: 88,911,541 L269P probably benign Het
Mtss1 A T 15: 58,956,538 D175E probably benign Het
Myef2 A T 2: 125,109,034 probably benign Het
Neb A T 2: 52,290,743 probably benign Het
Olfr1138 A G 2: 87,737,481 V281A probably damaging Het
Olfr1238 A T 2: 89,406,791 M96K probably damaging Het
Olfr305 T C 7: 86,363,827 N170S probably benign Het
Parp2 T A 14: 50,819,673 Y361N probably damaging Het
Parp3 A G 9: 106,471,796 F466L possibly damaging Het
Pcdh15 A T 10: 74,290,976 N296Y probably damaging Het
Pdzrn3 A T 6: 101,151,053 I884N probably damaging Het
Pim1 T C 17: 29,493,909 probably benign Het
Pou6f2 A G 13: 18,139,723 probably benign Het
Prelid3b A G 2: 174,465,950 probably benign Het
Proc G A 18: 32,125,118 T258I probably benign Het
Rab3gap2 T C 1: 185,260,508 probably benign Het
Rb1cc1 A C 1: 6,249,171 K938T probably benign Het
Rem2 T C 14: 54,476,297 probably benign Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rin2 A G 2: 145,861,033 K550E probably benign Het
Rps6ka4 G T 19: 6,840,498 T17N probably benign Het
Rtn4 T A 11: 29,733,849 probably benign Het
Ruvbl2 C T 7: 45,431,306 probably benign Het
Scaper A G 9: 55,758,062 probably benign Het
Sdc2 T C 15: 33,017,089 probably benign Het
Slc35e1 T C 8: 72,492,571 probably benign Het
Slco2b1 T A 7: 99,661,536 M603L probably benign Het
Smpdl3b A G 4: 132,745,138 V108A probably damaging Het
Sptbn4 C T 7: 27,361,566 probably null Het
Srrm1 G A 4: 135,338,543 probably benign Het
Ssh1 A T 5: 113,946,705 D448E probably benign Het
Ssmem1 A T 6: 30,519,548 probably null Het
Sv2b T G 7: 75,136,392 M427L probably benign Het
Syne1 A G 10: 5,367,600 L498P probably damaging Het
Syne2 T C 12: 75,854,149 probably null Het
Taf6l G T 19: 8,778,521 H254Q probably benign Het
Traf3ip3 T A 1: 193,178,231 probably null Het
Trpm1 G A 7: 64,223,758 G587D probably damaging Het
Ttn A G 2: 76,730,412 V29215A probably damaging Het
Ubr4 T G 4: 139,430,223 S2364A probably benign Het
Ush2a T A 1: 188,734,663 probably benign Het
Vmn2r100 C A 17: 19,522,120 P252Q possibly damaging Het
Vmn2r57 A T 7: 41,427,792 S317T possibly damaging Het
Vwa2 A G 19: 56,898,068 probably benign Het
Wdr73 G A 7: 80,897,950 Q107* probably null Het
Zbtb10 T A 3: 9,264,668 V362E probably damaging Het
Zfp217 C T 2: 170,115,462 A539T probably benign Het
Zfp296 A T 7: 19,577,906 M113L probably benign Het
Zfp729b A T 13: 67,591,134 V1004E probably benign Het
Other mutations in Fat3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00662:Fat3 APN 9 15996427 missense possibly damaging 0.77
IGL00962:Fat3 APN 9 15915519 missense probably benign 0.14
IGL00966:Fat3 APN 9 15999094 missense possibly damaging 0.69
IGL01100:Fat3 APN 9 16375228 missense probably damaging 1.00
IGL01104:Fat3 APN 9 16375728 missense possibly damaging 0.92
IGL01104:Fat3 APN 9 15998460 missense probably damaging 1.00
IGL01121:Fat3 APN 9 15998401 missense probably benign 0.00
IGL01407:Fat3 APN 9 16378023 missense probably benign 0.01
IGL01444:Fat3 APN 9 15998848 missense probably damaging 1.00
IGL01634:Fat3 APN 9 15998358 missense probably damaging 1.00
IGL01649:Fat3 APN 9 16376719 missense possibly damaging 0.95
IGL01839:Fat3 APN 9 15997872 missense probably damaging 1.00
IGL01867:Fat3 APN 9 16377901 missense probably benign 0.03
IGL01894:Fat3 APN 9 16375849 missense probably benign
IGL01913:Fat3 APN 9 15998790 missense probably damaging 0.99
IGL02033:Fat3 APN 9 15915352 missense possibly damaging 0.50
IGL02035:Fat3 APN 9 16377970 missense probably benign 0.06
IGL02146:Fat3 APN 9 15999582 missense probably benign
IGL02147:Fat3 APN 9 15995985 missense probably damaging 1.00
IGL02161:Fat3 APN 9 15997050 missense probably benign 0.10
IGL02161:Fat3 APN 9 15997051 nonsense probably null
IGL02164:Fat3 APN 9 16031424 splice site probably benign
IGL02269:Fat3 APN 9 15915577 missense possibly damaging 0.84
IGL02314:Fat3 APN 9 15969838 missense possibly damaging 0.61
IGL02393:Fat3 APN 9 15988412 nonsense probably null
IGL02410:Fat3 APN 9 15997845 missense probably damaging 1.00
IGL02504:Fat3 APN 9 15959798 missense probably damaging 1.00
IGL02572:Fat3 APN 9 15960506 missense probably benign
IGL02623:Fat3 APN 9 15997137 missense probably damaging 1.00
IGL02654:Fat3 APN 9 15996975 missense possibly damaging 0.84
IGL02749:Fat3 APN 9 16006711 missense possibly damaging 0.93
IGL02810:Fat3 APN 9 16376850 missense probably damaging 1.00
IGL02839:Fat3 APN 9 15919170 missense probably damaging 1.00
IGL02890:Fat3 APN 9 15915340 missense probably benign 0.03
IGL02892:Fat3 APN 9 16377562 missense probably damaging 1.00
IGL03090:Fat3 APN 9 16377239 nonsense probably null
IGL03144:Fat3 APN 9 16375245 missense probably damaging 1.00
IGL03199:Fat3 APN 9 16377048 missense possibly damaging 0.83
IGL03365:Fat3 APN 9 15996469 missense probably damaging 1.00
IGL03392:Fat3 APN 9 16003862 missense probably benign
IGL03408:Fat3 APN 9 15997957 nonsense probably null
gagged UTSW 9 15998271 missense probably damaging 1.00
Muffled UTSW 9 15937991 critical splice donor site probably null
Softened UTSW 9 16378185 missense probably benign
F6893:Fat3 UTSW 9 16006789 missense probably damaging 0.99
IGL03050:Fat3 UTSW 9 15996600 missense probably benign 0.04
PIT4142001:Fat3 UTSW 9 15992118 critical splice donor site probably null
PIT4283001:Fat3 UTSW 9 16006601 missense possibly damaging 0.77
PIT4378001:Fat3 UTSW 9 16376808 missense probably benign 0.05
PIT4434001:Fat3 UTSW 9 15996316 missense probably benign 0.00
PIT4468001:Fat3 UTSW 9 15996351 missense probably benign 0.06
R0001:Fat3 UTSW 9 16377873 missense probably damaging 0.99
R0005:Fat3 UTSW 9 15962866 missense probably damaging 1.00
R0005:Fat3 UTSW 9 15962866 missense probably damaging 1.00
R0038:Fat3 UTSW 9 15915010 missense probably damaging 1.00
R0046:Fat3 UTSW 9 15965979 missense possibly damaging 0.65
R0089:Fat3 UTSW 9 15938205 missense probably benign
R0135:Fat3 UTSW 9 16006777 missense probably damaging 1.00
R0255:Fat3 UTSW 9 15969706 splice site probably benign
R0349:Fat3 UTSW 9 16031180 missense probably damaging 1.00
R0361:Fat3 UTSW 9 15998403 missense possibly damaging 0.77
R0382:Fat3 UTSW 9 15959756 missense probably damaging 1.00
R0418:Fat3 UTSW 9 16246896 missense probably damaging 1.00
R0419:Fat3 UTSW 9 15992256 missense probably damaging 1.00
R0437:Fat3 UTSW 9 15996932 missense probably damaging 1.00
R0441:Fat3 UTSW 9 15945008 splice site probably benign
R0480:Fat3 UTSW 9 15997729 missense probably benign 0.00
R0665:Fat3 UTSW 9 15997402 missense probably benign
R0715:Fat3 UTSW 9 16375123 missense probably benign
R0727:Fat3 UTSW 9 15996699 missense probably damaging 1.00
R0882:Fat3 UTSW 9 16031368 missense possibly damaging 0.84
R0946:Fat3 UTSW 9 15997804 missense possibly damaging 0.95
R1068:Fat3 UTSW 9 15970034 missense probably benign
R1081:Fat3 UTSW 9 16375284 missense possibly damaging 0.62
R1082:Fat3 UTSW 9 16006615 missense probably damaging 1.00
R1148:Fat3 UTSW 9 15996774 missense probably damaging 1.00
R1148:Fat3 UTSW 9 15996774 missense probably damaging 1.00
R1233:Fat3 UTSW 9 15922745 missense probably benign
R1306:Fat3 UTSW 9 16376679 missense probably damaging 1.00
R1311:Fat3 UTSW 9 16021410 missense probably damaging 1.00
R1338:Fat3 UTSW 9 15925091 missense probably benign 0.00
R1395:Fat3 UTSW 9 16246916 missense probably benign 0.00
R1466:Fat3 UTSW 9 16375482 missense probably damaging 0.96
R1466:Fat3 UTSW 9 16375482 missense probably damaging 0.96
R1510:Fat3 UTSW 9 15960055 missense probably damaging 1.00
R1528:Fat3 UTSW 9 15925091 missense probably benign 0.00
R1531:Fat3 UTSW 9 15997465 missense probably damaging 1.00
R1659:Fat3 UTSW 9 15997183 missense possibly damaging 0.91
R1697:Fat3 UTSW 9 15944880 missense probably benign 0.05
R1699:Fat3 UTSW 9 15938398 missense probably damaging 1.00
R1728:Fat3 UTSW 9 15996315 missense possibly damaging 0.65
R1729:Fat3 UTSW 9 15996315 missense possibly damaging 0.65
R1731:Fat3 UTSW 9 15995937 missense probably benign
R1784:Fat3 UTSW 9 15996315 missense possibly damaging 0.65
R1789:Fat3 UTSW 9 16376985 missense probably benign 0.00
R1794:Fat3 UTSW 9 15997136 nonsense probably null
R1794:Fat3 UTSW 9 15997138 missense probably benign 0.15
R1830:Fat3 UTSW 9 15915340 missense probably benign 0.03
R1835:Fat3 UTSW 9 15998088 missense probably damaging 1.00
R1887:Fat3 UTSW 9 15967061 missense probably damaging 1.00
R1898:Fat3 UTSW 9 15960130 missense probably damaging 1.00
R1909:Fat3 UTSW 9 15998115 missense probably benign
R1912:Fat3 UTSW 9 15969988 missense probably damaging 1.00
R1917:Fat3 UTSW 9 15997057 missense possibly damaging 0.55
R1967:Fat3 UTSW 9 15968295 missense probably benign 0.00
R2070:Fat3 UTSW 9 15999370 missense probably benign 0.21
R2100:Fat3 UTSW 9 16377430 missense possibly damaging 0.73
R2104:Fat3 UTSW 9 15998517 missense possibly damaging 0.77
R2113:Fat3 UTSW 9 15999786 missense probably damaging 1.00
R2132:Fat3 UTSW 9 16246719 critical splice donor site probably null
R2136:Fat3 UTSW 9 16377051 missense probably benign 0.01
R2146:Fat3 UTSW 9 15990512 missense probably benign 0.01
R2233:Fat3 UTSW 9 15998271 missense probably damaging 1.00
R2234:Fat3 UTSW 9 15998271 missense probably damaging 1.00
R2273:Fat3 UTSW 9 15915262 missense probably benign
R2285:Fat3 UTSW 9 16376173 missense probably damaging 1.00
R2363:Fat3 UTSW 9 15998271 missense probably damaging 1.00
R2365:Fat3 UTSW 9 15998271 missense probably damaging 1.00
R2367:Fat3 UTSW 9 15998271 missense probably damaging 1.00
R2403:Fat3 UTSW 9 15969871 missense probably damaging 1.00
R2447:Fat3 UTSW 9 15998271 missense probably damaging 1.00
R2496:Fat3 UTSW 9 15966103 missense probably benign 0.01
R2509:Fat3 UTSW 9 15925014 missense possibly damaging 0.82
R2932:Fat3 UTSW 9 16375944 missense probably damaging 1.00
R2986:Fat3 UTSW 9 15992128 missense probably damaging 1.00
R3054:Fat3 UTSW 9 15960496 missense probably benign
R3056:Fat3 UTSW 9 15960496 missense probably benign
R3729:Fat3 UTSW 9 16247041 splice site probably benign
R3745:Fat3 UTSW 9 15998271 missense probably damaging 1.00
R3806:Fat3 UTSW 9 15998271 missense probably damaging 1.00
R3859:Fat3 UTSW 9 15997228 nonsense probably null
R3862:Fat3 UTSW 9 15998271 missense probably damaging 1.00
R3890:Fat3 UTSW 9 15998271 missense probably damaging 1.00
R3892:Fat3 UTSW 9 15998271 missense probably damaging 1.00
R3950:Fat3 UTSW 9 15998271 missense probably damaging 1.00
R3972:Fat3 UTSW 9 15998271 missense probably damaging 1.00
R4004:Fat3 UTSW 9 15998271 missense probably damaging 1.00
R4005:Fat3 UTSW 9 15998271 missense probably damaging 1.00
R4086:Fat3 UTSW 9 15998271 missense probably damaging 1.00
R4111:Fat3 UTSW 9 15998271 missense probably damaging 1.00
R4113:Fat3 UTSW 9 15998271 missense probably damaging 1.00
R4227:Fat3 UTSW 9 16377693 missense probably damaging 1.00
R4352:Fat3 UTSW 9 16246778 missense possibly damaging 0.55
R4394:Fat3 UTSW 9 15922792 missense probably benign 0.11
R4403:Fat3 UTSW 9 15944873 missense probably damaging 1.00
R4433:Fat3 UTSW 9 16031152 missense probably damaging 0.99
R4453:Fat3 UTSW 9 15998271 missense probably damaging 1.00
R4479:Fat3 UTSW 9 15998271 missense probably damaging 1.00
R4480:Fat3 UTSW 9 15998271 missense probably damaging 1.00
R4521:Fat3 UTSW 9 15922942 missense probably null 0.71
R4620:Fat3 UTSW 9 15996894 missense probably damaging 1.00
R4700:Fat3 UTSW 9 16031173 missense probably damaging 1.00
R4721:Fat3 UTSW 9 16029966 missense probably damaging 1.00
R4790:Fat3 UTSW 9 15998484 missense probably damaging 1.00
R4796:Fat3 UTSW 9 15999732 missense probably benign 0.17
R4823:Fat3 UTSW 9 15996507 missense probably benign
R4836:Fat3 UTSW 9 16377723 missense probably damaging 1.00
R4842:Fat3 UTSW 9 15997587 missense probably damaging 1.00
R4849:Fat3 UTSW 9 16377948 missense probably benign 0.03
R4856:Fat3 UTSW 9 16021330 missense probably benign
R4869:Fat3 UTSW 9 16377477 missense probably damaging 0.98
R4886:Fat3 UTSW 9 16021330 missense probably benign
R4899:Fat3 UTSW 9 15969799 missense probably damaging 1.00
R4941:Fat3 UTSW 9 16375152 missense probably damaging 1.00
R4986:Fat3 UTSW 9 15998340 missense probably damaging 1.00
R5058:Fat3 UTSW 9 15996858 missense probably damaging 1.00
R5079:Fat3 UTSW 9 15999127 missense probably benign 0.01
R5080:Fat3 UTSW 9 15999338 missense probably benign 0.35
R5174:Fat3 UTSW 9 15999570 missense probably damaging 1.00
R5183:Fat3 UTSW 9 15960313 missense probably damaging 0.99
R5203:Fat3 UTSW 9 16378142 missense possibly damaging 0.79
R5216:Fat3 UTSW 9 16377537 missense probably damaging 1.00
R5230:Fat3 UTSW 9 15990560 missense possibly damaging 0.51
R5318:Fat3 UTSW 9 16376629 missense probably damaging 1.00
R5377:Fat3 UTSW 9 16376443 missense probably benign 0.05
R5385:Fat3 UTSW 9 15922675 missense possibly damaging 0.82
R5436:Fat3 UTSW 9 15960514 missense probably benign 0.02
R5437:Fat3 UTSW 9 16085308 missense probably damaging 1.00
R5453:Fat3 UTSW 9 15996864 missense probably damaging 1.00
R5460:Fat3 UTSW 9 15919167 missense probably damaging 1.00
R5516:Fat3 UTSW 9 15998709 missense probably damaging 1.00
R5568:Fat3 UTSW 9 16376923 nonsense probably null
R5628:Fat3 UTSW 9 15966096 missense probably damaging 1.00
R5835:Fat3 UTSW 9 16375833 missense probably damaging 1.00
R5845:Fat3 UTSW 9 16377210 missense probably damaging 1.00
R5898:Fat3 UTSW 9 15938461 missense probably benign 0.15
R5941:Fat3 UTSW 9 15999501 missense probably benign 0.07
R5974:Fat3 UTSW 9 16006528 critical splice donor site probably null
R5986:Fat3 UTSW 9 15998317 missense probably benign 0.22
R6015:Fat3 UTSW 9 16376050 missense possibly damaging 0.55
R6031:Fat3 UTSW 9 15988492 missense probably benign 0.02
R6031:Fat3 UTSW 9 15988492 missense probably benign 0.02
R6042:Fat3 UTSW 9 16377817 missense probably benign 0.12
R6051:Fat3 UTSW 9 16375455 missense possibly damaging 0.83
R6052:Fat3 UTSW 9 15922679 missense probably null
R6119:Fat3 UTSW 9 16376568 missense possibly damaging 0.82
R6161:Fat3 UTSW 9 16377522 missense probably damaging 1.00
R6254:Fat3 UTSW 9 15996145 missense probably benign 0.19
R6318:Fat3 UTSW 9 15916984 intron probably benign
R6347:Fat3 UTSW 9 15998372 missense probably damaging 1.00
R6348:Fat3 UTSW 9 15937991 critical splice donor site probably null
R6351:Fat3 UTSW 9 15938398 missense probably damaging 1.00
R6450:Fat3 UTSW 9 15999170 missense possibly damaging 0.51
R6460:Fat3 UTSW 9 15967000 missense probably damaging 1.00
R6524:Fat3 UTSW 9 15992256 missense probably damaging 1.00
R6533:Fat3 UTSW 9 15998899 missense probably benign 0.02
R6565:Fat3 UTSW 9 15915327 missense probably benign
R6576:Fat3 UTSW 9 16377210 missense probably damaging 1.00
R6649:Fat3 UTSW 9 16376742 missense probably damaging 1.00
R6716:Fat3 UTSW 9 15919269 missense probably benign
R6719:Fat3 UTSW 9 15996144 missense probably benign
R6753:Fat3 UTSW 9 15915061 missense possibly damaging 0.82
R6754:Fat3 UTSW 9 15915061 missense possibly damaging 0.82
R6755:Fat3 UTSW 9 15915061 missense possibly damaging 0.82
R6792:Fat3 UTSW 9 16375644 missense probably damaging 1.00
R6802:Fat3 UTSW 9 15915061 missense possibly damaging 0.82
R6803:Fat3 UTSW 9 15996787 missense probably damaging 0.99
R6831:Fat3 UTSW 9 15915061 missense possibly damaging 0.82
R6831:Fat3 UTSW 9 16376551 missense probably damaging 0.98
R6833:Fat3 UTSW 9 15915061 missense possibly damaging 0.82
R6877:Fat3 UTSW 9 15999268 missense probably benign
R6894:Fat3 UTSW 9 15997776 missense probably damaging 1.00
R6915:Fat3 UTSW 9 16377748 missense probably benign 0.37
R6931:Fat3 UTSW 9 15959942 missense possibly damaging 0.89
R6934:Fat3 UTSW 9 16376956 missense probably damaging 0.98
R6940:Fat3 UTSW 9 15916800 intron probably null
R6959:Fat3 UTSW 9 15996885 missense possibly damaging 0.91
R6969:Fat3 UTSW 9 16029916 missense probably benign 0.29
R6986:Fat3 UTSW 9 16021335 missense probably damaging 1.00
R6993:Fat3 UTSW 9 15919221 missense probably damaging 1.00
R7039:Fat3 UTSW 9 16376265 missense probably damaging 1.00
R7051:Fat3 UTSW 9 16377827 missense probably damaging 1.00
R7089:Fat3 UTSW 9 15996918 missense probably benign 0.01
R7136:Fat3 UTSW 9 16378185 missense probably benign
R7137:Fat3 UTSW 9 15997148 missense probably damaging 1.00
R7154:Fat3 UTSW 9 15996864 missense probably damaging 1.00
R7170:Fat3 UTSW 9 16006574 missense probably damaging 0.99
R7183:Fat3 UTSW 9 15922837 missense possibly damaging 0.81
R7237:Fat3 UTSW 9 16377214 missense probably damaging 1.00
R7288:Fat3 UTSW 9 15998592 missense probably damaging 1.00
R7293:Fat3 UTSW 9 15915040 missense
R7293:Fat3 UTSW 9 15915296 missense
R7381:Fat3 UTSW 9 16246987 missense probably damaging 1.00
R7438:Fat3 UTSW 9 15988482 missense probably benign
R7537:Fat3 UTSW 9 15938319 missense probably damaging 1.00
R7560:Fat3 UTSW 9 15996842 missense probably damaging 1.00
R7585:Fat3 UTSW 9 15998262 missense probably benign 0.03
R7623:Fat3 UTSW 9 15988324 missense probably damaging 1.00
R7624:Fat3 UTSW 9 15959869 missense possibly damaging 0.72
R7684:Fat3 UTSW 9 15988268 critical splice donor site probably null
R7690:Fat3 UTSW 9 15998181 missense probably damaging 1.00
R7804:Fat3 UTSW 9 15990592 missense probably benign 0.01
R7809:Fat3 UTSW 9 16006628 missense probably damaging 1.00
RF006:Fat3 UTSW 9 15998617 missense probably benign 0.36
X0021:Fat3 UTSW 9 16029931 missense probably null 0.66
X0026:Fat3 UTSW 9 15996333 missense probably benign
X0064:Fat3 UTSW 9 15919277 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGCAGTGGACTCCACAATCTGATAC -3'
(R):5'- TTCCAAAGAGCCAGACATGGCAG -3'

Sequencing Primer
(F):5'- TACAATCTGCACACTGATGGTGG -3'
(R):5'- CAGACATGGCAGCTATGGGTC -3'
Posted On2013-06-12