Incidental Mutation 'R0510:Scaper'
ID47819
Institutional Source Beutler Lab
Gene Symbol Scaper
Ensembl Gene ENSMUSG00000034007
Gene NameS phase cyclin A-associated protein in the ER
SynonymsD530014O03Rik, Zfp291
MMRRC Submission 038704-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.573) question?
Stock #R0510 (G1)
Quality Score184
Status Validated
Chromosome9
Chromosomal Location55549879-55938119 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 55758062 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000149750 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037408] [ENSMUST00000214747] [ENSMUST00000216595] [ENSMUST00000217647]
Predicted Effect probably benign
Transcript: ENSMUST00000037408
SMART Domains Protein: ENSMUSP00000043411
Gene: ENSMUSG00000034007

DomainStartEndE-ValueType
Pfam:SCAPER_N 88 185 3.4e-47 PFAM
low complexity region 323 338 N/A INTRINSIC
coiled coil region 415 466 N/A INTRINSIC
coiled coil region 535 597 N/A INTRINSIC
SCOP:d1eq1a_ 605 769 3e-6 SMART
ZnF_C2H2 791 815 1.16e1 SMART
low complexity region 866 883 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000214747
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215323
Predicted Effect probably benign
Transcript: ENSMUST00000216595
Predicted Effect probably benign
Transcript: ENSMUST00000217647
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.2%
Validation Efficiency 99% (102/103)
Allele List at MGI
Other mutations in this stock
Total: 101 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933408B17Rik A T 18: 34,596,151 D42E probably damaging Het
Abcg3 A G 5: 104,977,616 I67T probably damaging Het
Acoxl G A 2: 127,880,503 probably null Het
Adam10 T A 9: 70,748,248 W333R probably damaging Het
Ahnak C T 19: 9,018,232 R5627* probably null Het
Alms1 A T 6: 85,620,369 R1195* probably null Het
Ap2m1 T A 16: 20,542,240 I334N possibly damaging Het
Camta1 C A 4: 151,075,140 R1614L probably damaging Het
Ccdc110 T A 8: 45,935,157 N50K probably benign Het
Cdhr1 T C 14: 37,080,676 Y610C probably damaging Het
Cdkal1 C A 13: 29,691,596 probably null Het
Celsr3 G A 9: 108,827,005 C229Y possibly damaging Het
Clca4b A T 3: 144,913,351 Y676N probably damaging Het
Col11a1 A T 3: 114,105,456 probably benign Het
Cpe T A 8: 64,611,467 I233F probably damaging Het
Cpsf1 A T 15: 76,603,657 probably benign Het
Cpsf2 T C 12: 101,988,786 V272A probably damaging Het
Creld2 A T 15: 88,819,956 N50I probably damaging Het
Cyb5r1 T C 1: 134,409,692 probably benign Het
Dcaf11 T C 14: 55,569,080 V446A probably damaging Het
Defa34 A G 8: 21,665,972 probably null Het
Dgat1 T C 15: 76,511,567 Y72C possibly damaging Het
Efr3b G T 12: 3,982,058 D183E probably benign Het
Enpp3 A T 10: 24,776,781 D759E probably damaging Het
Epyc A G 10: 97,649,763 T22A probably benign Het
Etfbkmt C T 6: 149,150,584 R96W probably benign Het
Fam83b G T 9: 76,492,826 L332I possibly damaging Het
Fat3 C A 9: 15,999,685 E1674* probably null Het
Fbn1 A G 2: 125,342,925 probably benign Het
Gm5134 C A 10: 75,974,245 T120N probably benign Het
Gm5415 T A 1: 32,545,875 N318I possibly damaging Het
Gm8251 T A 1: 44,061,097 K280N possibly damaging Het
Gmip C T 8: 69,815,609 probably benign Het
Gpbp1 G T 13: 111,440,745 Q204K possibly damaging Het
Gpr108 T C 17: 57,235,358 D549G possibly damaging Het
Gsdme C A 6: 50,246,127 probably benign Het
Gucy2e T C 11: 69,235,576 D326G probably benign Het
H2-Eb2 C T 17: 34,334,244 Q135* probably null Het
Hectd4 T A 5: 121,281,896 Y635N possibly damaging Het
Hectd4 G A 5: 121,305,673 E1319K possibly damaging Het
Hs3st2 T C 7: 121,500,569 S213P probably damaging Het
Ikbkb A T 8: 22,671,635 C412* probably null Het
Itpr2 T C 6: 146,417,979 T188A possibly damaging Het
Kcnh1 T A 1: 192,418,941 probably benign Het
Kctd21 T C 7: 97,347,541 F74L probably damaging Het
Krt23 T A 11: 99,486,782 I133L probably damaging Het
Krt74 T C 15: 101,763,316 noncoding transcript Het
Krt81 C A 15: 101,463,627 R24L possibly damaging Het
Lmtk3 T A 7: 45,794,112 L740M possibly damaging Het
Lrrc10 T A 10: 117,045,790 L123Q probably damaging Het
Map1a A T 2: 121,305,774 H2357L probably benign Het
Mbl1 A G 14: 41,158,749 N198S probably damaging Het
Mcf2l A G 8: 12,997,337 D233G probably damaging Het
Msto1 A G 3: 88,911,541 L269P probably benign Het
Mtss1 A T 15: 58,956,538 D175E probably benign Het
Myef2 A T 2: 125,109,034 probably benign Het
Neb A T 2: 52,290,743 probably benign Het
Olfr1138 A G 2: 87,737,481 V281A probably damaging Het
Olfr1238 A T 2: 89,406,791 M96K probably damaging Het
Olfr305 T C 7: 86,363,827 N170S probably benign Het
Parp2 T A 14: 50,819,673 Y361N probably damaging Het
Parp3 A G 9: 106,471,796 F466L possibly damaging Het
Pcdh15 A T 10: 74,290,976 N296Y probably damaging Het
Pdzrn3 A T 6: 101,151,053 I884N probably damaging Het
Pim1 T C 17: 29,493,909 probably benign Het
Pou6f2 A G 13: 18,139,723 probably benign Het
Prelid3b A G 2: 174,465,950 probably benign Het
Proc G A 18: 32,125,118 T258I probably benign Het
Rab3gap2 T C 1: 185,260,508 probably benign Het
Rb1cc1 A C 1: 6,249,171 K938T probably benign Het
Rem2 T C 14: 54,476,297 probably benign Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rin2 A G 2: 145,861,033 K550E probably benign Het
Rps6ka4 G T 19: 6,840,498 T17N probably benign Het
Rtn4 T A 11: 29,733,849 probably benign Het
Ruvbl2 C T 7: 45,431,306 probably benign Het
Sdc2 T C 15: 33,017,089 probably benign Het
Slc35e1 T C 8: 72,492,571 probably benign Het
Slco2b1 T A 7: 99,661,536 M603L probably benign Het
Smpdl3b A G 4: 132,745,138 V108A probably damaging Het
Sptbn4 C T 7: 27,361,566 probably null Het
Srrm1 G A 4: 135,338,543 probably benign Het
Ssh1 A T 5: 113,946,705 D448E probably benign Het
Ssmem1 A T 6: 30,519,548 probably null Het
Sv2b T G 7: 75,136,392 M427L probably benign Het
Syne1 A G 10: 5,367,600 L498P probably damaging Het
Syne2 T C 12: 75,854,149 probably null Het
Taf6l G T 19: 8,778,521 H254Q probably benign Het
Traf3ip3 T A 1: 193,178,231 probably null Het
Trpm1 G A 7: 64,223,758 G587D probably damaging Het
Ttn A G 2: 76,730,412 V29215A probably damaging Het
Ubr4 T G 4: 139,430,223 S2364A probably benign Het
Ush2a T A 1: 188,734,663 probably benign Het
Vmn2r100 C A 17: 19,522,120 P252Q possibly damaging Het
Vmn2r57 A T 7: 41,427,792 S317T possibly damaging Het
Vwa2 A G 19: 56,898,068 probably benign Het
Wdr73 G A 7: 80,897,950 Q107* probably null Het
Zbtb10 T A 3: 9,264,668 V362E probably damaging Het
Zfp217 C T 2: 170,115,462 A539T probably benign Het
Zfp296 A T 7: 19,577,906 M113L probably benign Het
Zfp729b A T 13: 67,591,134 V1004E probably benign Het
Other mutations in Scaper
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00653:Scaper APN 9 55859859 missense probably damaging 0.99
IGL00912:Scaper APN 9 55685955 missense probably damaging 1.00
IGL01469:Scaper APN 9 55859767 missense probably damaging 1.00
IGL01626:Scaper APN 9 55912051 missense possibly damaging 0.61
IGL01779:Scaper APN 9 55892240 missense probably benign 0.20
IGL02011:Scaper APN 9 55580322 missense probably damaging 1.00
IGL02997:Scaper APN 9 55815499 missense probably damaging 1.00
IGL03107:Scaper APN 9 55858402 splice site probably benign
IGL03167:Scaper APN 9 55859824 missense probably damaging 1.00
IGL03293:Scaper APN 9 55874823 missense probably benign
IGL03340:Scaper APN 9 55602832 missense possibly damaging 0.88
IGL03368:Scaper APN 9 55656027 missense possibly damaging 0.53
R0111:Scaper UTSW 9 55602790 missense probably benign 0.01
R0531:Scaper UTSW 9 55609874 missense possibly damaging 0.91
R0558:Scaper UTSW 9 55685923 missense probably benign 0.08
R0605:Scaper UTSW 9 55815518 splice site probably benign
R0646:Scaper UTSW 9 55758056 missense probably damaging 1.00
R0837:Scaper UTSW 9 55859042 nonsense probably null
R1440:Scaper UTSW 9 55602918 nonsense probably null
R1548:Scaper UTSW 9 55816670 missense probably damaging 1.00
R1777:Scaper UTSW 9 55864546 missense probably benign 0.33
R1822:Scaper UTSW 9 55859900 missense probably damaging 0.99
R1834:Scaper UTSW 9 55816734 missense possibly damaging 0.90
R1870:Scaper UTSW 9 55685938 missense probably damaging 1.00
R2102:Scaper UTSW 9 55912050 missense probably benign 0.43
R2168:Scaper UTSW 9 55743639 missense probably damaging 1.00
R2174:Scaper UTSW 9 55859037 missense probably null 0.01
R3690:Scaper UTSW 9 55883921 missense probably benign 0.00
R4392:Scaper UTSW 9 55858115 missense probably damaging 0.99
R4418:Scaper UTSW 9 55838180 missense probably damaging 1.00
R4606:Scaper UTSW 9 55655903 critical splice donor site probably null
R4643:Scaper UTSW 9 55838179 missense probably damaging 0.99
R4665:Scaper UTSW 9 55912055 missense probably damaging 1.00
R4739:Scaper UTSW 9 55743648 missense probably damaging 1.00
R4921:Scaper UTSW 9 55892235 missense probably benign 0.02
R4934:Scaper UTSW 9 55809175 missense probably damaging 1.00
R4956:Scaper UTSW 9 55838142 missense probably damaging 1.00
R5055:Scaper UTSW 9 55859719 intron probably null
R5107:Scaper UTSW 9 55580332 missense probably damaging 1.00
R5155:Scaper UTSW 9 55556086 missense probably null 1.00
R5265:Scaper UTSW 9 55864546 missense probably benign
R5408:Scaper UTSW 9 55586224 missense probably damaging 0.99
R5623:Scaper UTSW 9 55864507 missense probably benign 0.02
R5665:Scaper UTSW 9 55807632 missense probably damaging 1.00
R5748:Scaper UTSW 9 55859076 critical splice acceptor site probably null
R5771:Scaper UTSW 9 55816791 missense probably damaging 1.00
R6534:Scaper UTSW 9 55883976 missense probably benign 0.00
R6557:Scaper UTSW 9 55550850 missense probably benign 0.02
R6651:Scaper UTSW 9 55858504 missense probably benign 0.05
R6796:Scaper UTSW 9 55864427 missense probably benign 0.00
R6962:Scaper UTSW 9 55859771 missense probably benign 0.01
R7145:Scaper UTSW 9 55912111 missense unknown
R7199:Scaper UTSW 9 55838176 nonsense probably null
R7356:Scaper UTSW 9 55892211 missense unknown
R7426:Scaper UTSW 9 55762277 nonsense probably null
R7503:Scaper UTSW 9 55807754 missense probably damaging 0.98
X0012:Scaper UTSW 9 55655930 missense probably damaging 0.98
X0052:Scaper UTSW 9 55816664 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAAGCTTCTGTTTGAGGCCATTCC -3'
(R):5'- GGGCCAGGTCAGCTTATTTCCATAG -3'

Sequencing Primer
(F):5'- TGTTTGAGGCCATTCCTAAATTC -3'
(R):5'- CCAAGCCTATAAACTCAGTAGTATTC -3'
Posted On2013-06-12