Incidental Mutation 'R0510:Scaper'
ID 47819
Institutional Source Beutler Lab
Gene Symbol Scaper
Ensembl Gene ENSMUSG00000034007
Gene Name S phase cyclin A-associated protein in the ER
Synonyms Zfp291, D530014O03Rik
MMRRC Submission 038704-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.713) question?
Stock # R0510 (G1)
Quality Score 184
Status Validated
Chromosome 9
Chromosomal Location 55457163-55845403 bp(-) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) A to G at 55665346 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000149750 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037408] [ENSMUST00000214747] [ENSMUST00000216595] [ENSMUST00000217647]
AlphaFold F8VQ70
Predicted Effect probably benign
Transcript: ENSMUST00000037408
SMART Domains Protein: ENSMUSP00000043411
Gene: ENSMUSG00000034007

DomainStartEndE-ValueType
Pfam:SCAPER_N 88 185 3.4e-47 PFAM
low complexity region 323 338 N/A INTRINSIC
coiled coil region 415 466 N/A INTRINSIC
coiled coil region 535 597 N/A INTRINSIC
SCOP:d1eq1a_ 605 769 3e-6 SMART
ZnF_C2H2 791 815 1.16e1 SMART
low complexity region 866 883 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000214747
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215323
Predicted Effect probably benign
Transcript: ENSMUST00000216595
Predicted Effect probably benign
Transcript: ENSMUST00000217647
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.2%
Validation Efficiency 99% (102/103)
Allele List at MGI
Other mutations in this stock
Total: 101 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg3 A G 5: 105,125,482 (GRCm39) I67T probably damaging Het
Acoxl G A 2: 127,722,423 (GRCm39) probably null Het
Adam10 T A 9: 70,655,530 (GRCm39) W333R probably damaging Het
Ahnak C T 19: 8,995,596 (GRCm39) R5627* probably null Het
Alms1 A T 6: 85,597,351 (GRCm39) R1195* probably null Het
Ap2m1 T A 16: 20,360,990 (GRCm39) I334N possibly damaging Het
Brd8dc A T 18: 34,729,204 (GRCm39) D42E probably damaging Het
Camta1 C A 4: 151,159,597 (GRCm39) R1614L probably damaging Het
Ccdc110 T A 8: 46,388,194 (GRCm39) N50K probably benign Het
Ccdc168 T A 1: 44,100,257 (GRCm39) K280N possibly damaging Het
Cdhr1 T C 14: 36,802,633 (GRCm39) Y610C probably damaging Het
Cdkal1 C A 13: 29,875,579 (GRCm39) probably null Het
Celsr3 G A 9: 108,704,204 (GRCm39) C229Y possibly damaging Het
Clca4b A T 3: 144,619,112 (GRCm39) Y676N probably damaging Het
Col11a1 A T 3: 113,899,105 (GRCm39) probably benign Het
Cpe T A 8: 65,064,501 (GRCm39) I233F probably damaging Het
Cpsf1 A T 15: 76,487,857 (GRCm39) probably benign Het
Cpsf2 T C 12: 101,955,045 (GRCm39) V272A probably damaging Het
Creld2 A T 15: 88,704,159 (GRCm39) N50I probably damaging Het
Cyb5r1 T C 1: 134,337,430 (GRCm39) probably benign Het
Dcaf11 T C 14: 55,806,537 (GRCm39) V446A probably damaging Het
Defa34 A G 8: 22,155,988 (GRCm39) probably null Het
Dgat1 T C 15: 76,395,767 (GRCm39) Y72C possibly damaging Het
Efr3b G T 12: 4,032,058 (GRCm39) D183E probably benign Het
Enpp3 A T 10: 24,652,679 (GRCm39) D759E probably damaging Het
Epyc A G 10: 97,485,625 (GRCm39) T22A probably benign Het
Etfbkmt C T 6: 149,052,082 (GRCm39) R96W probably benign Het
Fam83b G T 9: 76,400,108 (GRCm39) L332I possibly damaging Het
Fat3 C A 9: 15,910,981 (GRCm39) E1674* probably null Het
Fbn1 A G 2: 125,184,845 (GRCm39) probably benign Het
Gm5134 C A 10: 75,810,079 (GRCm39) T120N probably benign Het
Gmip C T 8: 70,268,259 (GRCm39) probably benign Het
Gpbp1 G T 13: 111,577,279 (GRCm39) Q204K possibly damaging Het
Gpr108 T C 17: 57,542,358 (GRCm39) D549G possibly damaging Het
Gsdme C A 6: 50,223,107 (GRCm39) probably benign Het
Gucy2e T C 11: 69,126,402 (GRCm39) D326G probably benign Het
H2-Eb2 C T 17: 34,553,218 (GRCm39) Q135* probably null Het
Hectd4 T A 5: 121,419,959 (GRCm39) Y635N possibly damaging Het
Hectd4 G A 5: 121,443,736 (GRCm39) E1319K possibly damaging Het
Hs3st2 T C 7: 121,099,792 (GRCm39) S213P probably damaging Het
Ikbkb A T 8: 23,161,651 (GRCm39) C412* probably null Het
Itpr2 T C 6: 146,319,477 (GRCm39) T188A possibly damaging Het
Kcnh1 T A 1: 192,101,249 (GRCm39) probably benign Het
Kctd21 T C 7: 96,996,748 (GRCm39) F74L probably damaging Het
Krt23 T A 11: 99,377,608 (GRCm39) I133L probably damaging Het
Krt74 T C 15: 101,671,751 (GRCm39) noncoding transcript Het
Krt81 C A 15: 101,361,508 (GRCm39) R24L possibly damaging Het
Lmtk3 T A 7: 45,443,536 (GRCm39) L740M possibly damaging Het
Lrrc10 T A 10: 116,881,695 (GRCm39) L123Q probably damaging Het
Map1a A T 2: 121,136,255 (GRCm39) H2357L probably benign Het
Mbl1 A G 14: 40,880,706 (GRCm39) N198S probably damaging Het
Mcf2l A G 8: 13,047,337 (GRCm39) D233G probably damaging Het
Msto1 A G 3: 88,818,848 (GRCm39) L269P probably benign Het
Mtss1 A T 15: 58,828,387 (GRCm39) D175E probably benign Het
Myef2 A T 2: 124,950,954 (GRCm39) probably benign Het
Neb A T 2: 52,180,755 (GRCm39) probably benign Het
Or14a259 T C 7: 86,013,035 (GRCm39) N170S probably benign Het
Or4a39 A T 2: 89,237,135 (GRCm39) M96K probably damaging Het
Or5w15 A G 2: 87,567,825 (GRCm39) V281A probably damaging Het
Parp2 T A 14: 51,057,130 (GRCm39) Y361N probably damaging Het
Parp3 A G 9: 106,348,995 (GRCm39) F466L possibly damaging Het
Pcdh15 A T 10: 74,126,808 (GRCm39) N296Y probably damaging Het
Pdzrn3 A T 6: 101,128,014 (GRCm39) I884N probably damaging Het
Pim1 T C 17: 29,712,883 (GRCm39) probably benign Het
Pou6f2 A G 13: 18,314,308 (GRCm39) probably benign Het
Prelid3b A G 2: 174,307,743 (GRCm39) probably benign Het
Proc G A 18: 32,258,171 (GRCm39) T258I probably benign Het
Rab3gap2 T C 1: 184,992,705 (GRCm39) probably benign Het
Rb1cc1 A C 1: 6,319,395 (GRCm39) K938T probably benign Het
Rem2 T C 14: 54,713,754 (GRCm39) probably benign Het
Rif1 GCCACCA GCCA 2: 52,000,336 (GRCm39) probably benign Het
Rin2 A G 2: 145,702,953 (GRCm39) K550E probably benign Het
Rps6ka4 G T 19: 6,817,866 (GRCm39) T17N probably benign Het
Rtn4 T A 11: 29,683,849 (GRCm39) probably benign Het
Ruvbl2 C T 7: 45,080,730 (GRCm39) probably benign Het
Sdc2 T C 15: 33,017,235 (GRCm39) probably benign Het
Semp2l1 T A 1: 32,584,956 (GRCm39) N318I possibly damaging Het
Slc35e1 T C 8: 73,246,415 (GRCm39) probably benign Het
Slco2b1 T A 7: 99,310,743 (GRCm39) M603L probably benign Het
Smpdl3b A G 4: 132,472,449 (GRCm39) V108A probably damaging Het
Sptbn4 C T 7: 27,060,991 (GRCm39) probably null Het
Srrm1 G A 4: 135,065,854 (GRCm39) probably benign Het
Ssh1 A T 5: 114,084,766 (GRCm39) D448E probably benign Het
Ssmem1 A T 6: 30,519,547 (GRCm39) probably null Het
Sv2b T G 7: 74,786,140 (GRCm39) M427L probably benign Het
Syne1 A G 10: 5,317,600 (GRCm39) L498P probably damaging Het
Syne2 T C 12: 75,900,923 (GRCm39) probably null Het
Taf6l G T 19: 8,755,885 (GRCm39) H254Q probably benign Het
Traf3ip3 T A 1: 192,860,539 (GRCm39) probably null Het
Trpm1 G A 7: 63,873,506 (GRCm39) G587D probably damaging Het
Ttn A G 2: 76,560,756 (GRCm39) V29215A probably damaging Het
Ubr4 T G 4: 139,157,534 (GRCm39) S2364A probably benign Het
Ush2a T A 1: 188,466,860 (GRCm39) probably benign Het
Vmn2r100 C A 17: 19,742,382 (GRCm39) P252Q possibly damaging Het
Vmn2r57 A T 7: 41,077,216 (GRCm39) S317T possibly damaging Het
Vwa2 A G 19: 56,886,500 (GRCm39) probably benign Het
Wdr73 G A 7: 80,547,698 (GRCm39) Q107* probably null Het
Zbtb10 T A 3: 9,329,728 (GRCm39) V362E probably damaging Het
Zfp217 C T 2: 169,957,382 (GRCm39) A539T probably benign Het
Zfp296 A T 7: 19,311,831 (GRCm39) M113L probably benign Het
Zfp729b A T 13: 67,739,253 (GRCm39) V1004E probably benign Het
Other mutations in Scaper
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00653:Scaper APN 9 55,767,143 (GRCm39) missense probably damaging 0.99
IGL00912:Scaper APN 9 55,593,239 (GRCm39) missense probably damaging 1.00
IGL01469:Scaper APN 9 55,767,051 (GRCm39) missense probably damaging 1.00
IGL01626:Scaper APN 9 55,819,335 (GRCm39) missense possibly damaging 0.61
IGL01779:Scaper APN 9 55,799,524 (GRCm39) missense probably benign 0.20
IGL02011:Scaper APN 9 55,487,606 (GRCm39) missense probably damaging 1.00
IGL02997:Scaper APN 9 55,722,783 (GRCm39) missense probably damaging 1.00
IGL03107:Scaper APN 9 55,765,686 (GRCm39) splice site probably benign
IGL03167:Scaper APN 9 55,767,108 (GRCm39) missense probably damaging 1.00
IGL03293:Scaper APN 9 55,782,107 (GRCm39) missense probably benign
IGL03340:Scaper APN 9 55,510,116 (GRCm39) missense possibly damaging 0.88
IGL03368:Scaper APN 9 55,563,311 (GRCm39) missense possibly damaging 0.53
R0111:Scaper UTSW 9 55,510,074 (GRCm39) missense probably benign 0.01
R0531:Scaper UTSW 9 55,517,158 (GRCm39) missense possibly damaging 0.91
R0558:Scaper UTSW 9 55,593,207 (GRCm39) missense probably benign 0.08
R0605:Scaper UTSW 9 55,722,802 (GRCm39) splice site probably benign
R0646:Scaper UTSW 9 55,665,340 (GRCm39) missense probably damaging 1.00
R0837:Scaper UTSW 9 55,766,326 (GRCm39) nonsense probably null
R1440:Scaper UTSW 9 55,510,202 (GRCm39) nonsense probably null
R1548:Scaper UTSW 9 55,723,954 (GRCm39) missense probably damaging 1.00
R1777:Scaper UTSW 9 55,771,830 (GRCm39) missense probably benign 0.33
R1822:Scaper UTSW 9 55,767,184 (GRCm39) missense probably damaging 0.99
R1834:Scaper UTSW 9 55,724,018 (GRCm39) missense possibly damaging 0.90
R1870:Scaper UTSW 9 55,593,222 (GRCm39) missense probably damaging 1.00
R2102:Scaper UTSW 9 55,819,334 (GRCm39) missense probably benign 0.43
R2168:Scaper UTSW 9 55,650,923 (GRCm39) missense probably damaging 1.00
R2174:Scaper UTSW 9 55,766,321 (GRCm39) missense probably null 0.01
R3690:Scaper UTSW 9 55,791,205 (GRCm39) missense probably benign 0.00
R4392:Scaper UTSW 9 55,765,399 (GRCm39) missense probably damaging 0.99
R4418:Scaper UTSW 9 55,745,464 (GRCm39) missense probably damaging 1.00
R4606:Scaper UTSW 9 55,563,187 (GRCm39) critical splice donor site probably null
R4643:Scaper UTSW 9 55,745,463 (GRCm39) missense probably damaging 0.99
R4665:Scaper UTSW 9 55,819,339 (GRCm39) missense probably damaging 1.00
R4739:Scaper UTSW 9 55,650,932 (GRCm39) missense probably damaging 1.00
R4921:Scaper UTSW 9 55,799,519 (GRCm39) missense probably benign 0.02
R4934:Scaper UTSW 9 55,716,459 (GRCm39) missense probably damaging 1.00
R4956:Scaper UTSW 9 55,745,426 (GRCm39) missense probably damaging 1.00
R5055:Scaper UTSW 9 55,767,003 (GRCm39) splice site probably null
R5107:Scaper UTSW 9 55,487,616 (GRCm39) missense probably damaging 1.00
R5155:Scaper UTSW 9 55,463,370 (GRCm39) missense probably null 1.00
R5265:Scaper UTSW 9 55,771,830 (GRCm39) missense probably benign
R5408:Scaper UTSW 9 55,493,508 (GRCm39) missense probably damaging 0.99
R5623:Scaper UTSW 9 55,771,791 (GRCm39) missense probably benign 0.02
R5665:Scaper UTSW 9 55,714,916 (GRCm39) missense probably damaging 1.00
R5748:Scaper UTSW 9 55,766,360 (GRCm39) critical splice acceptor site probably null
R5771:Scaper UTSW 9 55,724,075 (GRCm39) missense probably damaging 1.00
R6534:Scaper UTSW 9 55,791,260 (GRCm39) missense probably benign 0.00
R6557:Scaper UTSW 9 55,458,134 (GRCm39) missense probably benign 0.02
R6651:Scaper UTSW 9 55,765,788 (GRCm39) missense probably benign 0.05
R6796:Scaper UTSW 9 55,771,711 (GRCm39) missense probably benign 0.00
R6962:Scaper UTSW 9 55,767,055 (GRCm39) missense probably benign 0.01
R7145:Scaper UTSW 9 55,819,395 (GRCm39) missense unknown
R7199:Scaper UTSW 9 55,745,460 (GRCm39) nonsense probably null
R7356:Scaper UTSW 9 55,799,495 (GRCm39) missense unknown
R7426:Scaper UTSW 9 55,669,561 (GRCm39) nonsense probably null
R7503:Scaper UTSW 9 55,715,038 (GRCm39) missense probably damaging 0.98
R7844:Scaper UTSW 9 55,722,732 (GRCm39) missense probably benign 0.04
R7966:Scaper UTSW 9 55,669,611 (GRCm39) missense probably damaging 0.98
R7992:Scaper UTSW 9 55,765,438 (GRCm39) missense probably benign 0.02
R8081:Scaper UTSW 9 55,823,330 (GRCm39) missense unknown
R8189:Scaper UTSW 9 55,819,404 (GRCm39) missense probably damaging 1.00
R8294:Scaper UTSW 9 55,517,280 (GRCm39) missense possibly damaging 0.62
R8351:Scaper UTSW 9 55,724,088 (GRCm39) missense possibly damaging 0.92
R8451:Scaper UTSW 9 55,724,088 (GRCm39) missense possibly damaging 0.92
R8473:Scaper UTSW 9 55,458,131 (GRCm39) missense probably damaging 1.00
R8476:Scaper UTSW 9 55,669,575 (GRCm39) missense probably damaging 1.00
R8504:Scaper UTSW 9 55,771,722 (GRCm39) missense probably benign
R9058:Scaper UTSW 9 55,722,762 (GRCm39) missense probably damaging 1.00
R9071:Scaper UTSW 9 55,771,803 (GRCm39) missense probably benign
R9099:Scaper UTSW 9 55,669,616 (GRCm39) missense probably damaging 0.98
R9104:Scaper UTSW 9 55,819,400 (GRCm39) missense unknown
R9516:Scaper UTSW 9 55,593,275 (GRCm39) missense probably benign 0.05
R9685:Scaper UTSW 9 55,771,835 (GRCm39) missense probably benign 0.10
X0012:Scaper UTSW 9 55,563,214 (GRCm39) missense probably damaging 0.98
X0052:Scaper UTSW 9 55,723,948 (GRCm39) missense probably damaging 1.00
Z1176:Scaper UTSW 9 55,463,532 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAAGCTTCTGTTTGAGGCCATTCC -3'
(R):5'- GGGCCAGGTCAGCTTATTTCCATAG -3'

Sequencing Primer
(F):5'- TGTTTGAGGCCATTCCTAAATTC -3'
(R):5'- CCAAGCCTATAAACTCAGTAGTATTC -3'
Posted On 2013-06-12