Incidental Mutation 'LCD18:Ocln'
ID478221
Institutional Source Beutler Lab
Gene Symbol Ocln
Ensembl Gene ENSMUSG00000021638
Gene Nameoccludin
SynonymsOcl
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.641) question?
Stock #LCD18 (G1)
Quality Score999
Status Validated
Chromosome13
Chromosomal Location100496507-100552718 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) C to T at 100520567 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000124849 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022140] [ENSMUST00000069756] [ENSMUST00000159459] [ENSMUST00000159515] [ENSMUST00000160859]
Predicted Effect probably benign
Transcript: ENSMUST00000022140
SMART Domains Protein: ENSMUSP00000022140
Gene: ENSMUSG00000021638

DomainStartEndE-ValueType
Pfam:MARVEL 57 261 6.6e-29 PFAM
Pfam:Occludin_ELL 419 518 8.8e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000069756
SMART Domains Protein: ENSMUSP00000065284
Gene: ENSMUSG00000021638

DomainStartEndE-ValueType
Pfam:MARVEL 57 261 3.3e-29 PFAM
Pfam:Occludin_ELL 419 518 3.8e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159459
SMART Domains Protein: ENSMUSP00000125642
Gene: ENSMUSG00000021638

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:Occludin_ELL 170 269 6.1e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159515
SMART Domains Protein: ENSMUSP00000125595
Gene: ENSMUSG00000021638

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160859
SMART Domains Protein: ENSMUSP00000124849
Gene: ENSMUSG00000021638

DomainStartEndE-ValueType
Pfam:MARVEL 57 261 6.6e-29 PFAM
Pfam:Occludin_ELL 419 518 8.8e-35 PFAM
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 88% (169/191)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an integral membrane protein that is required for cytokine-induced regulation of the tight junction paracellular permeability barrier. Mutations in this gene are thought to be a cause of band-like calcification with simplified gyration and polymicrogyria (BLC-PMG), an autosomal recessive neurologic disorder that is also known as pseudo-TORCH syndrome. Alternative splicing results in multiple transcript variants. A related pseudogene is present 1.5 Mb downstream on the q arm of chromosome 5. [provided by RefSeq, Apr 2011]
PHENOTYPE: Homozygous null mice display gastritis, loss of gastric parietal and chief cells, gastric mucus cell hyperplasia, reduced gastric acid secretion, growth retardation, male infertility, seminiferous tubule atrophy, failure to nurse pups, mineral deposits in the brain, and thinning of the compact bone. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 113 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007G11Rik G A 5: 98,707,508 probably benign Het
4930548H24Rik GAGAAG GAG 5: 31,487,373 probably benign Het
9530077C05Rik N 9: 22,442,083 probably benign Het
A330008L17Rik A G 8: 99,723,425 noncoding transcript Het
Aaed1 G A 13: 64,287,285 probably benign Het
Aff2 C A X: 69,747,535 probably benign Het
Aldh1a1 C A 19: 20,626,646 probably benign Het
Anxa7 C T 14: 20,469,411 G113E probably damaging Het
Apba2 A T 7: 64,622,160 probably benign Het
Apc2 G C 10: 80,299,974 probably benign Het
App C G 16: 85,025,412 probably benign Het
Asic2 C A 11: 80,985,744 probably benign Het
Btk T C X: 134,578,825 probably benign Het
C530008M17Rik GGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTG GGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTG 5: 76,658,742 probably benign Het
Car12 C A 9: 66,761,676 probably benign Het
Ccdc191 G A 16: 43,921,801 probably benign Het
Ccdc34 N 2: 110,016,318 probably benign Het
Cd164 G T 10: 41,521,926 A59S probably benign Het
Cd22 C T 7: 30,878,082 R2H possibly damaging Het
Cdv3 A T 9: 103,365,343 probably benign Het
Cdv3 C A 9: 103,365,354 probably benign Het
Celf2 N 2: 6,779,076 probably benign Het
Clec18a C A 8: 111,076,136 probably benign Het
Cnpy3 GGATGGAT GGATAGATAGATAGATAGATGGAT 17: 46,737,536 probably benign Het
Cntn4 A G 6: 106,553,940 probably benign Het
Cntnap5c G C 17: 58,162,160 probably benign Het
Col2a1 C A 15: 97,988,981 probably null Het
Cpne3 G T 4: 19,563,382 probably benign Het
Dab1 T G 4: 104,046,572 probably benign Het
Dapp1 G A 3: 137,939,400 probably benign Het
Dcc G A 18: 72,297,447 probably benign Het
Dcun1d1 GAAAAAAAAA GAAAAAAAAAA 3: 35,938,005 probably benign Het
Dennd1b G A 1: 139,114,764 probably benign Het
Dhdds TAA TA 4: 133,970,363 probably benign Het
Dnah12 G T 14: 26,849,385 G2817V probably damaging Het
Dnm3 CATATATATATATATATATATATA CATATATATATATATATATATA 1: 162,406,561 probably benign Het
Dock10 N 1: 80,716,623 probably benign Het
Dusp10 G T 1: 184,037,056 C73F probably damaging Het
Fgf20 A C 8: 40,292,318 probably benign Het
Ftsj3 G T 11: 106,250,059 probably benign Het
Gls T G 1: 52,183,367 probably benign Het
Gm12130 T C 11: 38,506,923 noncoding transcript Het
Gm12394 T C 4: 42,792,885 T416A probably benign Het
Gm14936 G A X: 112,998,750 noncoding transcript Het
Gm16630 C T 6: 48,141,269 noncoding transcript Het
Gm22194 AGTGTGTGTGTGTGTGTGTGTGTGTGTGTG AGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTG 10: 11,940,963 noncoding transcript Het
Gm26917 C G 17: 39,843,971 noncoding transcript Het
Gm35048 GACACACACACACACACACACACACACACACACACACAC GACACACACACACACACACACACACACACACACACAC 1: 90,521,526 noncoding transcript Het
Gm37311 G A 16: 77,618,281 noncoding transcript Het
Gm37928 AACACACACACACACACACACACACACACACACA AACACACACACACACACACACACACACACACACACA 3: 118,534,557 noncoding transcript Het
Gm42418 T C 17: 39,848,555 noncoding transcript Het
Gm4302 T C 10: 100,341,444 W197R probably benign Het
Gm5615 T C 9: 36,533,553 probably benign Het
H2-Q4 G A 17: 35,380,405 D155N probably damaging Het
H2-T23 T C 17: 36,031,216 probably benign Het
Hgs CTTTTTTT CTTTTTT 11: 120,469,578 probably benign Het
Ighv5-9 C T 12: 113,661,877 S82N probably benign Het
Il1rap C A 16: 26,631,593 probably benign Het
Inhbc N 10: 127,367,140 probably benign Het
Inpp4b C T 8: 81,693,010 probably benign Het
Kars N 8: 111,993,708 probably benign Het
Kcng4 G T 8: 119,633,519 Y39* probably null Het
Kcnh7 A G 2: 63,049,799 probably benign Het
Klhl1 G C 14: 96,317,730 probably benign Het
Lrch1 C T 14: 74,905,021 probably benign Het
Lrp1b G C 2: 42,237,562 probably benign Het
Lsm8 G A 6: 18,844,316 probably benign Het
Lsm8 G A 6: 18,854,321 probably benign Het
Magi2 T C 5: 19,954,511 probably benign Het
Marc2 TAGGCAGCCAATCAGAGCACTGCCTCTCAGCGCCAGGCAGCCAATCAGAGCACTGCCTCTCAGCGCCAGGCA TAGGCAGCCAATCAGAGCACTGCCTCTCAGCGCCAGGCA 1: 184,822,788 probably benign Het
Mef2c G A 13: 83,605,823 probably benign Het
Mei4 A G 9: 82,186,959 probably benign Het
Mid1 T A X: 170,005,564 probably benign Het
Mndal G C 1: 173,880,218 probably benign Het
Mpped2 C A 2: 106,721,428 probably benign Het
Mtf1 A G 4: 124,829,316 probably benign Het
Mxd1 T C 6: 86,667,406 probably benign Het
Nbea G T 3: 55,701,527 probably benign Het
Ncor1 N 11: 62,419,782 probably benign Het
Nox4 A G 7: 87,243,067 probably benign Het
Ofcc1 G A 13: 40,092,967 probably benign Het
Olfr313 T A 11: 58,817,440 V144D possibly damaging Het
Paics N 5: 76,956,744 probably null Het
Paqr8 G T 1: 20,914,658 probably benign Het
Pdss1 C T 2: 22,900,968 probably benign Het
Piezo1 G A 8: 122,495,569 R503W probably damaging Het
Pkhd1 G A 1: 20,611,414 probably benign Het
Ppp1r3f C A X: 7,560,336 G562V probably damaging Het
Prr16 C T 18: 51,200,324 probably benign Het
Prss38 T G 11: 59,375,641 probably benign Het
Ptprk T C 10: 28,574,987 probably benign Het
Pum1 N 4: 130,730,549 probably benign Het
Rabgef1 N 5: 130,187,586 probably null Het
Rgs16 G A 1: 153,744,230 probably benign Het
Riok3 G T 18: 12,129,982 probably benign Het
Robo2 N 16: 74,055,954 probably benign Het
Rps6ka3 A G X: 159,279,215 probably benign Het
Rptn T A 3: 93,397,541 L727Q probably benign Het
Slc25a46 C A 18: 31,597,313 probably benign Het
Spsb1 C T 4: 149,952,486 probably benign Het
Tbc1d19 A C 5: 53,816,709 probably benign Het
Trav7-4 C T 14: 53,461,518 L41F probably benign Het
Trip12 N 1: 84,754,482 probably benign Het
Ttc13 G A 8: 124,675,866 probably benign Het
Ttll6 C T 11: 96,155,258 probably benign Het
Unc5b C G 10: 60,786,171 probably benign Het
Vmn2r87 C T 10: 130,478,714 M334I probably benign Het
Vps13b G T 15: 35,846,957 A2629S probably damaging Het
Wars2 N 3: 99,214,774 probably null Het
Zdhhc3 AACACACACACACACACACACACACACACACAC AACACACACACACACACACACACACACACACACAC 9: 123,083,022 probably benign Het
Zfp26 C A 9: 20,438,546 A241S probably benign Het
Zfp442 C T 2: 150,419,848 probably benign Het
Zfp808 C T 13: 62,166,651 probably benign Het
Other mutations in Ocln
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Ocln APN 13 100535013 missense probably damaging 1.00
IGL02231:Ocln APN 13 100541114 missense probably damaging 1.00
R0635:Ocln UTSW 13 100506236 missense probably damaging 1.00
R1809:Ocln UTSW 13 100511459 nonsense probably null
R2047:Ocln UTSW 13 100535124 missense probably damaging 1.00
R2193:Ocln UTSW 13 100539904 missense probably damaging 0.99
R2259:Ocln UTSW 13 100535029 missense probably damaging 1.00
R3793:Ocln UTSW 13 100498894 missense possibly damaging 0.50
R4534:Ocln UTSW 13 100511604 missense possibly damaging 0.63
R4947:Ocln UTSW 13 100539715 missense probably damaging 1.00
R5055:Ocln UTSW 13 100539422 missense probably benign 0.11
R5061:Ocln UTSW 13 100539598 missense probably damaging 1.00
R5218:Ocln UTSW 13 100506314 missense probably damaging 1.00
R5302:Ocln UTSW 13 100506299 missense probably damaging 0.99
R5916:Ocln UTSW 13 100506179 missense possibly damaging 0.64
R6257:Ocln UTSW 13 100539509 missense probably benign 0.00
R6797:Ocln UTSW 13 100539715 missense probably damaging 1.00
R6960:Ocln UTSW 13 100498872 missense possibly damaging 0.89
R6967:Ocln UTSW 13 100539288 nonsense probably null
R7000:Ocln UTSW 13 100534962 critical splice donor site probably null
R7176:Ocln UTSW 13 100515082 missense probably damaging 0.97
R7176:Ocln UTSW 13 100515083 missense probably benign 0.16
R7709:Ocln UTSW 13 100539598 missense probably damaging 1.00
X0023:Ocln UTSW 13 100511582 missense probably benign 0.00
Z1088:Ocln UTSW 13 100535052 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGATGGGACTCTTACAGACATCTAAC -3'
(R):5'- TCTGGGACTTGGGCTTGAAC -3'

Sequencing Primer
(F):5'- CTCAGTGGTTAAGAGCTCTTCCAG -3'
(R):5'- GGACTTGGGCTTGAACTCTATAAC -3'
Posted On2017-05-26