Incidental Mutation 'LCD18:Cntnap5c'
ID478235
Institutional Source Beutler Lab
Gene Symbol Cntnap5c
Ensembl Gene ENSMUSG00000038048
Gene Namecontactin associated protein-like 5C
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #LCD18 (G1)
Quality Score999
Status Validated
Chromosome17
Chromosomal Location57769570-58410355 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) G to C at 58162160 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000075416 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076038]
Predicted Effect probably benign
Transcript: ENSMUST00000076038
SMART Domains Protein: ENSMUSP00000075416
Gene: ENSMUSG00000038048

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
FA58C 29 174 1.26e-10 SMART
LamG 201 338 1.57e-29 SMART
LamG 387 521 3e-26 SMART
EGF 549 583 1.88e-1 SMART
Blast:FBG 586 769 8e-83 BLAST
LamG 811 938 4.37e-28 SMART
EGF 959 995 6.55e-1 SMART
LamG 1036 1172 2.08e-11 SMART
transmembrane domain 1240 1262 N/A INTRINSIC
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 88% (169/191)
Allele List at MGI
Other mutations in this stock
Total: 113 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007G11Rik G A 5: 98,707,508 probably benign Het
4930548H24Rik GAGAAG GAG 5: 31,487,373 probably benign Het
9530077C05Rik N 9: 22,442,083 probably benign Het
A330008L17Rik A G 8: 99,723,425 noncoding transcript Het
Aaed1 G A 13: 64,287,285 probably benign Het
Aff2 C A X: 69,747,535 probably benign Het
Aldh1a1 C A 19: 20,626,646 probably benign Het
Anxa7 C T 14: 20,469,411 G113E probably damaging Het
Apba2 A T 7: 64,622,160 probably benign Het
Apc2 G C 10: 80,299,974 probably benign Het
App C G 16: 85,025,412 probably benign Het
Asic2 C A 11: 80,985,744 probably benign Het
Btk T C X: 134,578,825 probably benign Het
C530008M17Rik GGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTG GGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTG 5: 76,658,742 probably benign Het
Car12 C A 9: 66,761,676 probably benign Het
Ccdc191 G A 16: 43,921,801 probably benign Het
Ccdc34 N 2: 110,016,318 probably benign Het
Cd164 G T 10: 41,521,926 A59S probably benign Het
Cd22 C T 7: 30,878,082 R2H possibly damaging Het
Cdv3 A T 9: 103,365,343 probably benign Het
Cdv3 C A 9: 103,365,354 probably benign Het
Celf2 N 2: 6,779,076 probably benign Het
Clec18a C A 8: 111,076,136 probably benign Het
Cnpy3 GGATGGAT GGATAGATAGATAGATAGATGGAT 17: 46,737,536 probably benign Het
Cntn4 A G 6: 106,553,940 probably benign Het
Col2a1 C A 15: 97,988,981 probably null Het
Cpne3 G T 4: 19,563,382 probably benign Het
Dab1 T G 4: 104,046,572 probably benign Het
Dapp1 G A 3: 137,939,400 probably benign Het
Dcc G A 18: 72,297,447 probably benign Het
Dcun1d1 GAAAAAAAAA GAAAAAAAAAA 3: 35,938,005 probably benign Het
Dennd1b G A 1: 139,114,764 probably benign Het
Dhdds TAA TA 4: 133,970,363 probably benign Het
Dnah12 G T 14: 26,849,385 G2817V probably damaging Het
Dnm3 CATATATATATATATATATATATA CATATATATATATATATATATA 1: 162,406,561 probably benign Het
Dock10 N 1: 80,716,623 probably benign Het
Dusp10 G T 1: 184,037,056 C73F probably damaging Het
Fgf20 A C 8: 40,292,318 probably benign Het
Ftsj3 G T 11: 106,250,059 probably benign Het
Gls T G 1: 52,183,367 probably benign Het
Gm12130 T C 11: 38,506,923 noncoding transcript Het
Gm12394 T C 4: 42,792,885 T416A probably benign Het
Gm14936 G A X: 112,998,750 noncoding transcript Het
Gm16630 C T 6: 48,141,269 noncoding transcript Het
Gm22194 AGTGTGTGTGTGTGTGTGTGTGTGTGTGTG AGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTG 10: 11,940,963 noncoding transcript Het
Gm26917 C G 17: 39,843,971 noncoding transcript Het
Gm35048 GACACACACACACACACACACACACACACACACACACAC GACACACACACACACACACACACACACACACACACAC 1: 90,521,526 noncoding transcript Het
Gm37311 G A 16: 77,618,281 noncoding transcript Het
Gm37928 AACACACACACACACACACACACACACACACACA AACACACACACACACACACACACACACACACACACA 3: 118,534,557 noncoding transcript Het
Gm42418 T C 17: 39,848,555 noncoding transcript Het
Gm4302 T C 10: 100,341,444 W197R probably benign Het
Gm5615 T C 9: 36,533,553 probably benign Het
H2-Q4 G A 17: 35,380,405 D155N probably damaging Het
H2-T23 T C 17: 36,031,216 probably benign Het
Hgs CTTTTTTT CTTTTTT 11: 120,469,578 probably benign Het
Ighv5-9 C T 12: 113,661,877 S82N probably benign Het
Il1rap C A 16: 26,631,593 probably benign Het
Inhbc N 10: 127,367,140 probably benign Het
Inpp4b C T 8: 81,693,010 probably benign Het
Kars N 8: 111,993,708 probably benign Het
Kcng4 G T 8: 119,633,519 Y39* probably null Het
Kcnh7 A G 2: 63,049,799 probably benign Het
Klhl1 G C 14: 96,317,730 probably benign Het
Lrch1 C T 14: 74,905,021 probably benign Het
Lrp1b G C 2: 42,237,562 probably benign Het
Lsm8 G A 6: 18,844,316 probably benign Het
Lsm8 G A 6: 18,854,321 probably benign Het
Magi2 T C 5: 19,954,511 probably benign Het
Marc2 TAGGCAGCCAATCAGAGCACTGCCTCTCAGCGCCAGGCAGCCAATCAGAGCACTGCCTCTCAGCGCCAGGCA TAGGCAGCCAATCAGAGCACTGCCTCTCAGCGCCAGGCA 1: 184,822,788 probably benign Het
Mef2c G A 13: 83,605,823 probably benign Het
Mei4 A G 9: 82,186,959 probably benign Het
Mid1 T A X: 170,005,564 probably benign Het
Mndal G C 1: 173,880,218 probably benign Het
Mpped2 C A 2: 106,721,428 probably benign Het
Mtf1 A G 4: 124,829,316 probably benign Het
Mxd1 T C 6: 86,667,406 probably benign Het
Nbea G T 3: 55,701,527 probably benign Het
Ncor1 N 11: 62,419,782 probably benign Het
Nox4 A G 7: 87,243,067 probably benign Het
Ocln C T 13: 100,520,567 probably benign Het
Ofcc1 G A 13: 40,092,967 probably benign Het
Olfr313 T A 11: 58,817,440 V144D possibly damaging Het
Paics N 5: 76,956,744 probably null Het
Paqr8 G T 1: 20,914,658 probably benign Het
Pdss1 C T 2: 22,900,968 probably benign Het
Piezo1 G A 8: 122,495,569 R503W probably damaging Het
Pkhd1 G A 1: 20,611,414 probably benign Het
Ppp1r3f C A X: 7,560,336 G562V probably damaging Het
Prr16 C T 18: 51,200,324 probably benign Het
Prss38 T G 11: 59,375,641 probably benign Het
Ptprk T C 10: 28,574,987 probably benign Het
Pum1 N 4: 130,730,549 probably benign Het
Rabgef1 N 5: 130,187,586 probably null Het
Rgs16 G A 1: 153,744,230 probably benign Het
Riok3 G T 18: 12,129,982 probably benign Het
Robo2 N 16: 74,055,954 probably benign Het
Rps6ka3 A G X: 159,279,215 probably benign Het
Rptn T A 3: 93,397,541 L727Q probably benign Het
Slc25a46 C A 18: 31,597,313 probably benign Het
Spsb1 C T 4: 149,952,486 probably benign Het
Tbc1d19 A C 5: 53,816,709 probably benign Het
Trav7-4 C T 14: 53,461,518 L41F probably benign Het
Trip12 N 1: 84,754,482 probably benign Het
Ttc13 G A 8: 124,675,866 probably benign Het
Ttll6 C T 11: 96,155,258 probably benign Het
Unc5b C G 10: 60,786,171 probably benign Het
Vmn2r87 C T 10: 130,478,714 M334I probably benign Het
Vps13b G T 15: 35,846,957 A2629S probably damaging Het
Wars2 N 3: 99,214,774 probably null Het
Zdhhc3 AACACACACACACACACACACACACACACACAC AACACACACACACACACACACACACACACACACAC 9: 123,083,022 probably benign Het
Zfp26 C A 9: 20,438,546 A241S probably benign Het
Zfp442 C T 2: 150,419,848 probably benign Het
Zfp808 C T 13: 62,166,651 probably benign Het
Other mutations in Cntnap5c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00495:Cntnap5c APN 17 58162277 missense probably benign 0.00
IGL00543:Cntnap5c APN 17 58294350 missense probably benign
IGL00679:Cntnap5c APN 17 58055678 missense probably damaging 0.98
IGL00942:Cntnap5c APN 17 57769598 missense probably benign 0.03
IGL01352:Cntnap5c APN 17 58293901 missense probably benign 0.00
IGL01822:Cntnap5c APN 17 58055705 missense probably damaging 0.99
IGL01864:Cntnap5c APN 17 58410242 missense probably benign
IGL01922:Cntnap5c APN 17 58330119 missense possibly damaging 0.95
IGL02111:Cntnap5c APN 17 58102108 missense probably damaging 1.00
IGL02112:Cntnap5c APN 17 58313858 missense probably benign 0.00
IGL02259:Cntnap5c APN 17 58034862 missense probably damaging 0.98
IGL02270:Cntnap5c APN 17 58034853 missense probably benign 0.08
IGL02312:Cntnap5c APN 17 58138699 missense probably benign 0.09
IGL02456:Cntnap5c APN 17 58407744 splice site probably benign
IGL02755:Cntnap5c APN 17 58364194 missense probably benign 0.02
IGL02955:Cntnap5c APN 17 57892102 splice site probably benign
IGL03001:Cntnap5c APN 17 58055639 missense probably damaging 1.00
IGL03012:Cntnap5c APN 17 58359234 missense probably benign 0.01
IGL03243:Cntnap5c APN 17 58102176 missense probably benign 0.01
IGL03375:Cntnap5c APN 17 58162205 missense possibly damaging 0.94
IGL02802:Cntnap5c UTSW 17 58305684 missense probably benign 0.04
R0003:Cntnap5c UTSW 17 58199017 missense probably benign
R0041:Cntnap5c UTSW 17 57876469 missense probably benign 0.00
R0041:Cntnap5c UTSW 17 57876469 missense probably benign 0.00
R0046:Cntnap5c UTSW 17 58359300 missense probably benign
R0046:Cntnap5c UTSW 17 58359300 missense probably benign
R0179:Cntnap5c UTSW 17 57769625 missense probably benign 0.19
R0244:Cntnap5c UTSW 17 58102168 missense probably damaging 1.00
R0445:Cntnap5c UTSW 17 58104743 missense probably benign 0.01
R0626:Cntnap5c UTSW 17 58042427 missense probably benign 0.29
R0675:Cntnap5c UTSW 17 58034995 missense probably damaging 1.00
R0681:Cntnap5c UTSW 17 58305555 missense possibly damaging 0.91
R0699:Cntnap5c UTSW 17 58042498 missense probably damaging 1.00
R0927:Cntnap5c UTSW 17 58042558 missense possibly damaging 0.78
R1081:Cntnap5c UTSW 17 58305525 missense possibly damaging 0.90
R1132:Cntnap5c UTSW 17 58294356 missense probably damaging 1.00
R1175:Cntnap5c UTSW 17 58364246 missense possibly damaging 0.51
R1640:Cntnap5c UTSW 17 58395294 missense probably benign 0.01
R1664:Cntnap5c UTSW 17 58293990 missense probably benign 0.00
R1758:Cntnap5c UTSW 17 58042550 missense probably damaging 1.00
R1785:Cntnap5c UTSW 17 58162291 missense probably benign 0.00
R1789:Cntnap5c UTSW 17 58013921 missense probably damaging 1.00
R1968:Cntnap5c UTSW 17 58359296 missense probably damaging 1.00
R2041:Cntnap5c UTSW 17 58104770 critical splice donor site probably null
R2041:Cntnap5c UTSW 17 58198989 missense probably benign 0.02
R2073:Cntnap5c UTSW 17 58305552 missense possibly damaging 0.58
R2093:Cntnap5c UTSW 17 58199000 missense probably benign 0.00
R2134:Cntnap5c UTSW 17 58407722 missense probably damaging 1.00
R2153:Cntnap5c UTSW 17 58055671 missense possibly damaging 0.90
R2176:Cntnap5c UTSW 17 58013946 missense probably benign 0.04
R2256:Cntnap5c UTSW 17 58330315 missense probably benign 0.00
R2847:Cntnap5c UTSW 17 57876392 missense probably damaging 0.99
R2848:Cntnap5c UTSW 17 57876392 missense probably damaging 0.99
R2850:Cntnap5c UTSW 17 58410348 utr 3 prime probably benign
R3008:Cntnap5c UTSW 17 58359209 missense probably damaging 1.00
R3714:Cntnap5c UTSW 17 57892067 nonsense probably null
R3720:Cntnap5c UTSW 17 58330202 missense probably benign
R3755:Cntnap5c UTSW 17 58104599 missense possibly damaging 0.82
R4001:Cntnap5c UTSW 17 58407740 critical splice donor site probably null
R4619:Cntnap5c UTSW 17 58410268 missense probably benign
R5146:Cntnap5c UTSW 17 58013847 missense probably damaging 0.96
R5309:Cntnap5c UTSW 17 58359254 missense probably benign 0.05
R5312:Cntnap5c UTSW 17 58359254 missense probably benign 0.05
R5722:Cntnap5c UTSW 17 58313857 missense probably benign 0.01
R5974:Cntnap5c UTSW 17 57876485 missense probably benign 0.00
R6017:Cntnap5c UTSW 17 58104698 missense probably benign 0.41
R6059:Cntnap5c UTSW 17 58313712 missense probably damaging 0.99
R6152:Cntnap5c UTSW 17 58286886 missense possibly damaging 0.65
R6182:Cntnap5c UTSW 17 57876395 missense probably benign 0.00
R6298:Cntnap5c UTSW 17 58104752 missense probably damaging 1.00
R6301:Cntnap5c UTSW 17 57892037 missense probably benign 0.01
R6514:Cntnap5c UTSW 17 58330170 missense probably damaging 0.96
R6583:Cntnap5c UTSW 17 58330277 missense probably damaging 1.00
R6688:Cntnap5c UTSW 17 58293904 missense possibly damaging 0.71
R6781:Cntnap5c UTSW 17 58138653 nonsense probably null
R6866:Cntnap5c UTSW 17 58092294 missense probably benign
R6906:Cntnap5c UTSW 17 58395307 missense probably benign 0.18
R6911:Cntnap5c UTSW 17 57892014 missense probably damaging 1.00
R6919:Cntnap5c UTSW 17 58293953 missense probably benign 0.02
R6923:Cntnap5c UTSW 17 58092350 missense possibly damaging 0.96
R6925:Cntnap5c UTSW 17 58395266 missense probably benign 0.39
R6982:Cntnap5c UTSW 17 58092252 missense possibly damaging 0.77
R7144:Cntnap5c UTSW 17 58286888 missense probably benign
R7422:Cntnap5c UTSW 17 58410231 nonsense probably null
R7797:Cntnap5c UTSW 17 58359275 missense probably benign 0.11
R7830:Cntnap5c UTSW 17 58162250 missense probably damaging 1.00
RF010:Cntnap5c UTSW 17 58286795 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGACTGGTGGTTCTTGCCTC -3'
(R):5'- ATACCATCTGTTATCCAGGTTAAGC -3'

Sequencing Primer
(F):5'- GTGAGCTAAAAGGAGTCCATTCTCAC -3'
(R):5'- CTGTTATCCAGGTTAAGCATTCTTAG -3'
Posted On2017-05-26