Incidental Mutation 'R5353:Sp110'
ID478259
Institutional Source Beutler Lab
Gene Symbol Sp110
Ensembl Gene ENSMUSG00000070034
Gene NameSp110 nuclear body protein
Synonyms5830484A20Rik, Ipr1, Ifi75, 5031415C07Rik, 52kDa
MMRRC Submission 042932-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.322) question?
Stock #R5353 (G1)
Quality Score22
Status Validated
Chromosome1
Chromosomal Location85576899-85598817 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 85589120 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 219 (E219K)
Ref Sequence ENSEMBL: ENSMUSP00000091226 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093508]
PDB Structure
Solution structure of the SAND domain of the putative nuclear protein homolog (5830484A20Rik) [SOLUTION NMR]
Predicted Effect possibly damaging
Transcript: ENSMUST00000093508
AA Change: E219K

PolyPhen 2 Score 0.785 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000091226
Gene: ENSMUSG00000070034
AA Change: E219K

DomainStartEndE-ValueType
Pfam:Sp100 8 106 2.3e-41 PFAM
low complexity region 242 254 N/A INTRINSIC
low complexity region 259 269 N/A INTRINSIC
SAND 360 433 3.55e-28 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128339
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131950
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143363
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186740
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.2%
Validation Efficiency 100% (59/59)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim3 A G 18: 61,801,399 S649P probably damaging Het
Adam22 C A 5: 8,090,182 G202W probably damaging Het
Adamts1 T A 16: 85,802,608 M35L probably benign Het
Adgrg3 A T 8: 95,035,928 H202L probably damaging Het
Anln G T 9: 22,360,517 R681S probably damaging Het
Aprt A T 8: 122,575,408 M1K probably null Het
Arid3b G T 9: 57,795,037 probably null Het
BC080695 A G 4: 143,571,237 T76A probably benign Het
Cbl A G 9: 44,173,323 F172L probably damaging Het
Cd109 G T 9: 78,710,239 V1340L probably damaging Het
Cdc45 C T 16: 18,795,897 R205H probably damaging Het
Chrm3 A G 13: 9,878,557 Y148H probably damaging Het
Cog7 A C 7: 121,941,247 probably null Het
Cpsf1 A T 15: 76,602,571 I255N probably damaging Het
Crebzf G A 7: 90,443,414 G134R probably damaging Het
Crybg1 T C 10: 43,973,665 S1705G probably damaging Het
Dock6 A T 9: 21,814,786 H1409Q probably benign Het
Fank1 A G 7: 133,876,903 D232G probably damaging Het
Fat1 G T 8: 45,036,131 V3480L probably benign Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Fmn2 G T 1: 174,503,006 G321W unknown Het
Greb1 A T 12: 16,688,566 Y1465* probably null Het
Hdac9 G A 12: 34,393,393 Q330* probably null Het
Kcnt2 C T 1: 140,426,901 T298I probably damaging Het
Knl1 A G 2: 119,070,983 D1055G probably benign Het
Mroh2b T C 15: 4,917,178 S487P probably damaging Het
Naa38 G A 11: 69,396,582 V110I probably benign Het
Nkd2 T C 13: 73,821,438 H303R probably damaging Het
Nr1d2 A G 14: 18,222,125 C49R probably benign Het
Olfr1216 A G 2: 89,013,755 V103A probably benign Het
Olfr691 A G 7: 105,337,117 Y200H probably damaging Het
Ovch2 T A 7: 107,794,424 E165V probably damaging Het
Phyh A T 2: 4,942,201 probably benign Het
Pik3r4 G A 9: 105,667,938 probably null Het
Ppip5k1 A C 2: 121,311,720 V1416G probably benign Het
Ppm1b T C 17: 84,994,109 V139A probably benign Het
Ppp1r12a T G 10: 108,261,216 probably null Het
Psmc5 G T 11: 106,261,501 A115S probably damaging Het
Ptpn5 T A 7: 47,081,894 E409V probably benign Het
Ptprg T A 14: 11,554,235 probably benign Het
Qrich1 G T 9: 108,544,965 V593F probably damaging Het
Rbbp9 T C 2: 144,543,821 I175V probably benign Het
Selenot T C 3: 58,585,966 F88S possibly damaging Het
Spred2 A G 11: 20,018,155 D208G possibly damaging Het
Surf1 T C 2: 26,914,192 T197A probably benign Het
Taco1 G A 11: 106,072,713 probably null Het
Tas2r109 A G 6: 132,980,631 V112A possibly damaging Het
Tpr C T 1: 150,445,924 R3C probably damaging Het
Uggt2 A G 14: 119,081,770 I280T probably benign Het
Yipf2 A G 9: 21,591,932 Y80H possibly damaging Het
Zscan12 T C 13: 21,364,008 V120A possibly damaging Het
Other mutations in Sp110
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00503:Sp110 APN 1 85577329 missense probably benign
IGL00510:Sp110 APN 1 85577329 missense probably benign
IGL00516:Sp110 APN 1 85577329 missense probably benign
IGL00990:Sp110 APN 1 85586281 missense possibly damaging 0.51
IGL03382:Sp110 APN 1 85577329 missense probably benign
FR4342:Sp110 UTSW 1 85587488 small insertion probably benign
FR4976:Sp110 UTSW 1 85587489 small insertion probably benign
IGL03147:Sp110 UTSW 1 85591567 frame shift probably null
PIT4131001:Sp110 UTSW 1 85586250 missense probably benign 0.05
PIT4131001:Sp110 UTSW 1 85586254 missense probably benign 0.01
PIT4142001:Sp110 UTSW 1 85586250 missense probably benign 0.05
PIT4142001:Sp110 UTSW 1 85586254 missense probably benign 0.01
R0472:Sp110 UTSW 1 85589120 missense possibly damaging 0.79
R0483:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R0551:Sp110 UTSW 1 85589100 splice site probably benign
R0638:Sp110 UTSW 1 85577329 missense probably benign
R0806:Sp110 UTSW 1 85586254 missense probably benign 0.01
R0806:Sp110 UTSW 1 85586281 missense possibly damaging 0.51
R1074:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R1079:Sp110 UTSW 1 85589104 splice site probably benign
R1228:Sp110 UTSW 1 85591760 missense probably benign 0.03
R1403:Sp110 UTSW 1 85579079 missense probably benign 0.00
R1406:Sp110 UTSW 1 85579079 missense probably benign 0.00
R1418:Sp110 UTSW 1 85594385 missense probably benign 0.08
R1718:Sp110 UTSW 1 85594385 missense probably benign 0.08
R1744:Sp110 UTSW 1 85594372 missense probably benign 0.26
R1747:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R1806:Sp110 UTSW 1 85596110 critical splice acceptor site probably null
R1957:Sp110 UTSW 1 85577329 missense probably benign
R2404:Sp110 UTSW 1 85577329 missense probably benign
R2964:Sp110 UTSW 1 85577329 missense probably benign
R3176:Sp110 UTSW 1 85577329 missense probably benign
R4190:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R4398:Sp110 UTSW 1 85577329 missense probably benign
R4505:Sp110 UTSW 1 85589173 missense probably damaging 1.00
R4565:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R4625:Sp110 UTSW 1 85577329 missense probably benign
R4922:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R4986:Sp110 UTSW 1 85591760 missense probably benign 0.03
R5014:Sp110 UTSW 1 85577329 missense probably benign
R5080:Sp110 UTSW 1 85596055 nonsense probably null
R5087:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R5254:Sp110 UTSW 1 85577202 utr 3 prime probably benign
R5335:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R5383:Sp110 UTSW 1 85591569 frame shift probably null
R5387:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R5389:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R5398:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R5443:Sp110 UTSW 1 85589120 missense possibly damaging 0.79
R5447:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R5729:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R5752:Sp110 UTSW 1 85577202 utr 3 prime probably benign
R5754:Sp110 UTSW 1 85577202 utr 3 prime probably benign
R5799:Sp110 UTSW 1 85577329 missense probably benign
R6027:Sp110 UTSW 1 85577318 missense possibly damaging 0.83
R6171:Sp110 UTSW 1 85577329 missense probably benign
R6367:Sp110 UTSW 1 85594292 missense probably benign 0.00
R6771:Sp110 UTSW 1 85592279 intron probably null
R7097:Sp110 UTSW 1 85579685 missense possibly damaging 0.80
R7519:Sp110 UTSW 1 85579092 missense
R7520:Sp110 UTSW 1 85579092 missense
R7594:Sp110 UTSW 1 85579092 missense
R7596:Sp110 UTSW 1 85579092 missense
R7598:Sp110 UTSW 1 85579092 missense
R7600:Sp110 UTSW 1 85579092 missense
R7601:Sp110 UTSW 1 85579092 missense
R7602:Sp110 UTSW 1 85579092 missense
R7640:Sp110 UTSW 1 85579092 missense
R7641:Sp110 UTSW 1 85579092 missense
R7674:Sp110 UTSW 1 85579092 missense
R7691:Sp110 UTSW 1 85579092 missense
R7695:Sp110 UTSW 1 85579092 missense
R8072:Sp110 UTSW 1 85587486 small insertion probably benign
X0035:Sp110 UTSW 1 85586254 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AAGCTATCCCAAGCAAGGTTG -3'
(R):5'- CTGCCTTCCTTACTGGTTAGAA -3'

Sequencing Primer
(F):5'- GTTGCTAAGAGTTAAGTCAGCC -3'
(R):5'- GCCTTCCTTACTGGTTAGAATCACTG -3'
Posted On2017-06-01