Mutagenetix > Incidental Mutation

Incidental Mutation 'R5367:Mroh2a'

478261

Institutional Source

Beutler Lab

Gene Symbol

Mroh2a

Ensembl Gene

ENSMUSG00000079429

Gene Name

maestro heat-like repeat family member 2A

Synonyms

ENSMUSG00000044873, Heatr7b1, OTTMUSG00000020804

MMRRC Submission

042945-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.947) question?

Stock #

R5367 (G1)

Quality Score

Status

Validated

Chromosome

Chromosomal Location

88154713-88190011 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 88182687 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Isoleucine at position 1205 (N1205I)

Ref Sequence

ENSEMBL: ENSMUSP00000130508 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000061013] [ENSMUST00000113130] [ENSMUST00000135948]

AlphaFold

D3Z750

Predicted Effect

possibly damaging
Transcript: ENSMUST00000061013
AA Change: N1205I

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000130508
Gene: ENSMUSG00000079429
AA Change: N1205I

Domain	Start	End	E-Value	Type
low complexity region	9	26	N/A	INTRINSIC
low complexity region	99	112	N/A	INTRINSIC
low complexity region	1235	1248	N/A	INTRINSIC
SCOP:d1jdha_	1371	1669	9e-8	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000113130
AA Change: N1202I

PolyPhen 2 Score 0.909 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000108755
Gene: ENSMUSG00000079429
AA Change: N1202I

Domain	Start	End	E-Value	Type
low complexity region	9	26	N/A	INTRINSIC
low complexity region	99	112	N/A	INTRINSIC
low complexity region	1232	1245	N/A	INTRINSIC
SCOP:d1gw5a_	1446	1671	6e-6	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000135948

SMART Domains

Protein: ENSMUSP00000118971
Gene: ENSMUSG00000079429

Domain	Start	End	E-Value	Type
SCOP:d1gw5a_	15	174	5e-6	SMART

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.3%
20x: 95.5%

Validation Efficiency

97% (70/72)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a HEAT-domain-containing protein. The function of the encoded protein has not been characterized. [provided by RefSeq, Aug 2016]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aadac	T	C	3: 59,947,057 (GRCm39)	Y252H	probably damaging	Het
Aadat	T	C	8: 60,979,630 (GRCm39)	I164T	probably damaging	Het
Adam11	A	G	11: 102,664,479 (GRCm39)	H389R	probably benign	Het
Alkbh5	G	T	11: 60,429,529 (GRCm39)	R94L	possibly damaging	Het
Ampd3	A	G	7: 110,407,078 (GRCm39)	K644R	possibly damaging	Het
Ankhd1	T	A	18: 36,722,461 (GRCm39)	L328H	probably damaging	Het
Ankrd55	G	T	13: 112,455,036 (GRCm39)	V45F	probably damaging	Het
Apol7c	C	A	15: 77,410,347 (GRCm39)	V200F	probably damaging	Het
Arap1	G	A	7: 101,058,337 (GRCm39)	V721M	probably damaging	Het
Arhgef40	A	G	14: 52,227,156 (GRCm39)	D400G	probably damaging	Het
Bmp4	G	T	14: 46,621,950 (GRCm39)	T198K	possibly damaging	Het
Cblb	T	A	16: 52,025,016 (GRCm39)	F970L	probably damaging	Het
Celf5	A	G	10: 81,303,098 (GRCm39)	S148P	probably damaging	Het
Ckap5	T	A	2: 91,445,486 (GRCm39)	C1708S	possibly damaging	Het
Clec2l	T	C	6: 38,654,459 (GRCm39)	F147L	possibly damaging	Het
Cnksr1	T	A	4: 133,957,525 (GRCm39)	I465F	possibly damaging	Het
Coq10b	A	G	1: 55,092,143 (GRCm39)	D37G	probably benign	Het
Cpq	T	G	15: 33,213,250 (GRCm39)	Y90D	possibly damaging	Het
Depdc1a	G	A	3: 159,229,591 (GRCm39)		probably null	Het
Eif2ak4	T	A	2: 118,266,639 (GRCm39)		probably null	Het
Eif3e	C	T	15: 43,115,700 (GRCm39)	M355I	probably damaging	Het
Eif4e1b	G	A	13: 54,934,757 (GRCm39)	V181M	probably damaging	Het
Erap1	A	G	13: 74,794,680 (GRCm39)	E113G	probably damaging	Het
Fads2	A	G	19: 10,041,649 (GRCm39)	L438P	probably damaging	Het
Fbl	T	A	7: 27,874,475 (GRCm39)	V67E	probably damaging	Het
Gde1	A	G	7: 118,304,629 (GRCm39)	L82P	probably damaging	Het
Gm10226	T	C	17: 21,910,884 (GRCm39)	S40P	possibly damaging	Het
Gm10717	T	G	9: 3,026,317 (GRCm39)	F205C	probably damaging	Het
Gm1988	T	A	7: 38,823,204 (GRCm39)		noncoding transcript	Het
Gm6728	T	C	6: 136,463,502 (GRCm39)		noncoding transcript	Het
Grb14	C	T	2: 64,747,653 (GRCm39)	V369I	probably benign	Het
Jag1	T	A	2: 136,927,014 (GRCm39)	Q915L	possibly damaging	Het
Kdm5d	G	A	Y: 941,645 (GRCm39)	G1282D	probably benign	Het
Krt87	A	T	15: 101,384,875 (GRCm39)	L407Q	probably damaging	Het
Mlf1	A	T	3: 67,301,296 (GRCm39)	H118L	probably damaging	Het
Mmp10	G	T	9: 7,505,603 (GRCm39)	C289F	probably damaging	Het
Myo9a	T	A	9: 59,807,732 (GRCm39)	S2029T	probably damaging	Het
Nap1l4	A	C	7: 143,088,035 (GRCm39)	S174R	probably damaging	Het
Nos3	A	G	5: 24,576,942 (GRCm39)	T490A	probably benign	Het
Or12d2	T	A	17: 37,625,147 (GRCm39)	I43F	probably damaging	Het
Or4k35	T	A	2: 111,100,235 (GRCm39)	Q159L	possibly damaging	Het
Or5a1	A	G	19: 12,097,800 (GRCm39)	V80A	possibly damaging	Het
Or5b106	G	A	19: 13,123,865 (GRCm39)	L53F	probably damaging	Het
Or5g23	A	T	2: 85,438,718 (GRCm39)	C179S	probably damaging	Het
Pdlim7	G	C	13: 55,653,975 (GRCm39)	T214S	probably benign	Het
Piezo2	T	C	18: 63,197,802 (GRCm39)	E1578G	probably damaging	Het
Ptcd1	T	A	5: 145,084,715 (GRCm39)		probably benign	Het
Sart3	C	T	5: 113,897,277 (GRCm39)		probably null	Het
Scara5	CG	C	14: 65,997,111 (GRCm39)		probably null	Het
Scrn2	A	G	11: 96,923,953 (GRCm39)	D279G	possibly damaging	Het
Sh2d3c	A	G	2: 32,635,914 (GRCm39)	D94G	probably damaging	Het
Slc12a4	A	T	8: 106,678,266 (GRCm39)	V309E	probably damaging	Het
Slc1a6	A	G	10: 78,623,637 (GRCm39)	E12G	probably damaging	Het
Smarcal1	T	C	1: 72,635,135 (GRCm39)		probably null	Het
Smr3a	T	C	5: 88,155,897 (GRCm39)		probably benign	Het
Stox2	A	G	8: 47,656,260 (GRCm39)	I72T	probably damaging	Het
Tmem234	G	T	4: 129,494,500 (GRCm39)		probably benign	Het
Tmem35b	A	G	4: 127,018,266 (GRCm39)	Q20R	possibly damaging	Het
Tom1l2	G	A	11: 60,132,634 (GRCm39)	H430Y	probably benign	Het
Tpo	T	C	12: 30,153,289 (GRCm39)	Y355C	probably damaging	Het
Tulp2	A	G	7: 45,166,075 (GRCm39)	N122S	possibly damaging	Het
Washc2	T	A	6: 116,236,111 (GRCm39)	L1194H	probably damaging	Het
Xbp1	T	C	11: 5,471,910 (GRCm39)	V12A	probably benign	Het

Other mutations in Mroh2a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00990:Mroh2a	APN	1	88,172,692 (GRCm39)	missense	probably benign	0.03
IGL00990:Mroh2a	APN	1	88,161,842 (GRCm39)	missense	possibly damaging	0.76
IGL00990:Mroh2a	APN	1	88,158,468 (GRCm39)	missense	probably damaging	0.99
IGL03097:Mroh2a	UTSW	1	88,163,098 (GRCm39)	missense	probably benign	0.30
R0032:Mroh2a	UTSW	1	88,183,888 (GRCm39)	frame shift	probably null
R0068:Mroh2a	UTSW	1	88,183,888 (GRCm39)	frame shift	probably null
R0139:Mroh2a	UTSW	1	88,185,524 (GRCm39)	missense	probably damaging	1.00
R0197:Mroh2a	UTSW	1	88,173,764 (GRCm39)	missense	probably damaging	1.00
R0242:Mroh2a	UTSW	1	88,170,142 (GRCm39)	missense	possibly damaging	0.77
R0322:Mroh2a	UTSW	1	88,158,402 (GRCm39)	nonsense	probably null
R0374:Mroh2a	UTSW	1	88,170,142 (GRCm39)	missense	possibly damaging	0.77
R0387:Mroh2a	UTSW	1	88,173,764 (GRCm39)	missense	probably damaging	1.00
R0412:Mroh2a	UTSW	1	88,162,938 (GRCm39)	missense	probably benign	0.01
R0536:Mroh2a	UTSW	1	88,186,386 (GRCm39)	missense	probably benign	0.00
R0548:Mroh2a	UTSW	1	88,170,142 (GRCm39)	missense	possibly damaging	0.77
R0580:Mroh2a	UTSW	1	88,171,672 (GRCm39)	missense	probably damaging	1.00
R0581:Mroh2a	UTSW	1	88,183,888 (GRCm39)	frame shift	probably null
R0583:Mroh2a	UTSW	1	88,183,888 (GRCm39)	frame shift	probably null
R0613:Mroh2a	UTSW	1	88,171,672 (GRCm39)	missense	probably damaging	1.00
R0652:Mroh2a	UTSW	1	88,158,402 (GRCm39)	nonsense	probably null
R0657:Mroh2a	UTSW	1	88,183,287 (GRCm39)	missense	probably damaging	1.00
R0659:Mroh2a	UTSW	1	88,170,142 (GRCm39)	missense	possibly damaging	0.77
R0659:Mroh2a	UTSW	1	88,178,064 (GRCm39)	missense	probably damaging	1.00
R0671:Mroh2a	UTSW	1	88,170,142 (GRCm39)	missense	possibly damaging	0.77
R0675:Mroh2a	UTSW	1	88,156,102 (GRCm39)	missense	probably damaging	0.99
R0675:Mroh2a	UTSW	1	88,178,064 (GRCm39)	missense	probably damaging	1.00
R0689:Mroh2a	UTSW	1	88,186,386 (GRCm39)	missense	probably benign	0.00
R0689:Mroh2a	UTSW	1	88,158,402 (GRCm39)	nonsense	probably null
R0735:Mroh2a	UTSW	1	88,171,672 (GRCm39)	missense	probably damaging	1.00
R0761:Mroh2a	UTSW	1	88,171,672 (GRCm39)	missense	probably damaging	1.00
R0766:Mroh2a	UTSW	1	88,158,402 (GRCm39)	nonsense	probably null
R0845:Mroh2a	UTSW	1	88,186,386 (GRCm39)	missense	probably benign	0.00
R0853:Mroh2a	UTSW	1	88,186,386 (GRCm39)	missense	probably benign	0.00
R0959:Mroh2a	UTSW	1	88,159,979 (GRCm39)	frame shift	probably null
R0960:Mroh2a	UTSW	1	88,170,142 (GRCm39)	missense	possibly damaging	0.77
R1004:Mroh2a	UTSW	1	88,170,142 (GRCm39)	missense	possibly damaging	0.77
R1013:Mroh2a	UTSW	1	88,162,334 (GRCm39)	critical splice donor site	probably null
R1028:Mroh2a	UTSW	1	88,163,098 (GRCm39)	missense	probably benign	0.30
R1268:Mroh2a	UTSW	1	88,158,402 (GRCm39)	nonsense	probably null
R1281:Mroh2a	UTSW	1	88,183,889 (GRCm39)	frame shift	probably null
R1414:Mroh2a	UTSW	1	88,186,386 (GRCm39)	missense	probably benign	0.00
R1439:Mroh2a	UTSW	1	88,185,524 (GRCm39)	missense	probably damaging	1.00
R1441:Mroh2a	UTSW	1	88,169,353 (GRCm39)	missense	possibly damaging	0.93
R1442:Mroh2a	UTSW	1	88,160,075 (GRCm39)	splice site	probably benign
R1442:Mroh2a	UTSW	1	88,170,142 (GRCm39)	missense	possibly damaging	0.77
R1465:Mroh2a	UTSW	1	88,185,524 (GRCm39)	missense	probably damaging	1.00
R1662:Mroh2a	UTSW	1	88,169,340 (GRCm39)	missense	probably benign	0.07
R1686:Mroh2a	UTSW	1	88,158,402 (GRCm39)	nonsense	probably null
R1686:Mroh2a	UTSW	1	88,162,334 (GRCm39)	critical splice donor site	probably null
R1780:Mroh2a	UTSW	1	88,158,402 (GRCm39)	nonsense	probably null
R1846:Mroh2a	UTSW	1	88,186,386 (GRCm39)	missense	probably benign	0.00
R1899:Mroh2a	UTSW	1	88,163,098 (GRCm39)	missense	probably benign	0.30
R1958:Mroh2a	UTSW	1	88,165,213 (GRCm39)	nonsense	probably null
R2122:Mroh2a	UTSW	1	88,184,476 (GRCm39)	missense	probably benign	0.37
R2248:Mroh2a	UTSW	1	88,184,476 (GRCm39)	missense	probably benign	0.37
R2306:Mroh2a	UTSW	1	88,186,386 (GRCm39)	missense	probably benign	0.00
R2869:Mroh2a	UTSW	1	88,159,979 (GRCm39)	frame shift	probably null
R2870:Mroh2a	UTSW	1	88,159,979 (GRCm39)	frame shift	probably null
R2871:Mroh2a	UTSW	1	88,183,287 (GRCm39)	missense	probably damaging	1.00
R2872:Mroh2a	UTSW	1	88,159,979 (GRCm39)	frame shift	probably null
R3408:Mroh2a	UTSW	1	88,159,979 (GRCm39)	frame shift	probably null
R3608:Mroh2a	UTSW	1	88,172,717 (GRCm39)	missense	probably damaging	1.00
R3730:Mroh2a	UTSW	1	88,159,979 (GRCm39)	frame shift	probably null
R3937:Mroh2a	UTSW	1	88,186,386 (GRCm39)	missense	probably benign	0.00
R4022:Mroh2a	UTSW	1	88,173,764 (GRCm39)	missense	probably damaging	1.00
R4049:Mroh2a	UTSW	1	88,186,386 (GRCm39)	missense	probably benign	0.00
R4133:Mroh2a	UTSW	1	88,182,687 (GRCm39)	missense	possibly damaging	0.95
R4361:Mroh2a	UTSW	1	88,182,687 (GRCm39)	missense	possibly damaging	0.95
R4392:Mroh2a	UTSW	1	88,187,311 (GRCm39)	missense	probably damaging	1.00
R4401:Mroh2a	UTSW	1	88,182,657 (GRCm39)	missense	possibly damaging	0.72
R4402:Mroh2a	UTSW	1	88,182,657 (GRCm39)	missense	possibly damaging	0.72
R4575:Mroh2a	UTSW	1	88,186,386 (GRCm39)	missense	probably benign	0.00
R4625:Mroh2a	UTSW	1	88,182,687 (GRCm39)	missense	possibly damaging	0.95
R4631:Mroh2a	UTSW	1	88,186,386 (GRCm39)	missense	probably benign	0.00
R4665:Mroh2a	UTSW	1	88,169,340 (GRCm39)	missense	probably benign	0.07
R4701:Mroh2a	UTSW	1	88,162,334 (GRCm39)	critical splice donor site	probably null
R4701:Mroh2a	UTSW	1	88,169,340 (GRCm39)	missense	probably benign	0.07
R4771:Mroh2a	UTSW	1	88,179,087 (GRCm39)	missense	probably damaging	1.00
R4795:Mroh2a	UTSW	1	88,186,386 (GRCm39)	missense	probably benign	0.00
R4839:Mroh2a	UTSW	1	88,165,666 (GRCm39)	missense	probably damaging	1.00
R4873:Mroh2a	UTSW	1	88,182,657 (GRCm39)	missense	possibly damaging	0.72
R4875:Mroh2a	UTSW	1	88,182,657 (GRCm39)	missense	possibly damaging	0.72
R4896:Mroh2a	UTSW	1	88,184,476 (GRCm39)	missense	probably benign	0.37
R5007:Mroh2a	UTSW	1	88,159,979 (GRCm39)	frame shift	probably null
R5031:Mroh2a	UTSW	1	88,159,979 (GRCm39)	frame shift	probably null
R5062:Mroh2a	UTSW	1	88,159,979 (GRCm39)	frame shift	probably null
R5301:Mroh2a	UTSW	1	88,186,386 (GRCm39)	missense	probably benign	0.00
R5371:Mroh2a	UTSW	1	88,186,386 (GRCm39)	missense	probably benign	0.00
R5446:Mroh2a	UTSW	1	88,182,687 (GRCm39)	missense	possibly damaging	0.95
R5484:Mroh2a	UTSW	1	88,186,386 (GRCm39)	missense	probably benign	0.00
R5506:Mroh2a	UTSW	1	88,186,386 (GRCm39)	missense	probably benign	0.00
R5561:Mroh2a	UTSW	1	88,159,979 (GRCm39)	frame shift	probably null
R5615:Mroh2a	UTSW	1	88,159,979 (GRCm39)	frame shift	probably null
R5825:Mroh2a	UTSW	1	88,158,402 (GRCm39)	nonsense	probably null
R5891:Mroh2a	UTSW	1	88,169,337 (GRCm39)	missense	possibly damaging	0.93
R5906:Mroh2a	UTSW	1	88,186,386 (GRCm39)	missense	probably benign	0.00
R5928:Mroh2a	UTSW	1	88,169,340 (GRCm39)	missense	probably benign	0.07
R6004:Mroh2a	UTSW	1	88,176,377 (GRCm39)	missense	probably damaging	1.00
R6035:Mroh2a	UTSW	1	88,158,390 (GRCm39)	missense	probably damaging	1.00
R6064:Mroh2a	UTSW	1	88,159,979 (GRCm39)	frame shift	probably null
R6074:Mroh2a	UTSW	1	88,186,386 (GRCm39)	missense	probably benign	0.00
R6091:Mroh2a	UTSW	1	88,159,979 (GRCm39)	frame shift	probably null
R6127:Mroh2a	UTSW	1	88,162,334 (GRCm39)	critical splice donor site	probably null
R6234:Mroh2a	UTSW	1	88,184,476 (GRCm39)	missense	probably benign	0.37
R6234:Mroh2a	UTSW	1	88,162,334 (GRCm39)	critical splice donor site	probably null
R6244:Mroh2a	UTSW	1	88,184,476 (GRCm39)	missense	probably benign	0.37
R6464:Mroh2a	UTSW	1	88,185,524 (GRCm39)	missense	probably damaging	1.00
R6465:Mroh2a	UTSW	1	88,159,979 (GRCm39)	frame shift	probably null
R6575:Mroh2a	UTSW	1	88,159,979 (GRCm39)	frame shift	probably null
R6809:Mroh2a	UTSW	1	88,162,938 (GRCm39)	missense	probably benign	0.01
R6819:Mroh2a	UTSW	1	88,170,142 (GRCm39)	missense	possibly damaging	0.77
R6854:Mroh2a	UTSW	1	88,171,672 (GRCm39)	missense	probably damaging	1.00
R6860:Mroh2a	UTSW	1	88,182,657 (GRCm39)	missense	possibly damaging	0.72
R7126:Mroh2a	UTSW	1	88,182,657 (GRCm39)	missense	possibly damaging	0.72
R7818:Mroh2a	UTSW	1	88,162,334 (GRCm39)	critical splice donor site	probably null
R8350:Mroh2a	UTSW	1	88,171,805 (GRCm39)	splice site	probably null
R9414:Mroh2a	UTSW	1	88,179,096 (GRCm39)	missense	probably benign	0.26
RF024:Mroh2a	UTSW	1	88,170,207 (GRCm39)	missense	probably damaging	1.00
V5622:Mroh2a	UTSW	1	88,154,813 (GRCm39)	start gained	probably benign
V8831:Mroh2a	UTSW	1	88,183,889 (GRCm39)	frame shift	probably null
X0027:Mroh2a	UTSW	1	88,176,335 (GRCm39)	missense	possibly damaging	0.86
X0028:Mroh2a	UTSW	1	88,183,888 (GRCm39)	frame shift	probably null
X0028:Mroh2a	UTSW	1	88,159,979 (GRCm39)	frame shift	probably null
X0033:Mroh2a	UTSW	1	88,183,888 (GRCm39)	frame shift	probably null
X0034:Mroh2a	UTSW	1	88,183,888 (GRCm39)	frame shift	probably null
X0034:Mroh2a	UTSW	1	88,160,014 (GRCm39)	missense	probably damaging	1.00
X0034:Mroh2a	UTSW	1	88,159,979 (GRCm39)	frame shift	probably null
X0039:Mroh2a	UTSW	1	88,159,979 (GRCm39)	frame shift	probably null
X0057:Mroh2a	UTSW	1	88,183,888 (GRCm39)	frame shift	probably null
X0057:Mroh2a	UTSW	1	88,183,377 (GRCm39)	missense	probably benign	0.25
X0057:Mroh2a	UTSW	1	88,159,979 (GRCm39)	frame shift	probably null
X0063:Mroh2a	UTSW	1	88,159,979 (GRCm39)	frame shift	probably null
Z1188:Mroh2a	UTSW	1	88,162,938 (GRCm39)	missense	probably benign	0.01
Z1190:Mroh2a	UTSW	1	88,159,979 (GRCm39)	frame shift	probably null
Z1192:Mroh2a	UTSW	1	88,162,938 (GRCm39)	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- AACTCTTTGCTTAGGGGTCCCC -3'
(R):5'- CAGGTCAGGAAACAGGTCTG -3'

Sequencing Primer
(F):5'- CCAGGGGGTGTCACGAG -3'
(R):5'- CAGGTCTGGAAATTTGTCATCC -3'

Posted On

2017-06-05