Incidental Mutation 'R5393:Cpsf6'
ID478267
Institutional Source Beutler Lab
Gene Symbol Cpsf6
Ensembl Gene ENSMUSG00000055531
Gene Namecleavage and polyadenylation specific factor 6
SynonymsHPBRII-4, CFIM68, 4733401N12Rik, HPBRII-7
MMRRC Submission 042965-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.947) question?
Stock #R5393 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location117344673-117380015 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) G to C at 117362016 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000135550 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069168] [ENSMUST00000175924] [ENSMUST00000176480] [ENSMUST00000176670] [ENSMUST00000176686] [ENSMUST00000177145]
Predicted Effect unknown
Transcript: ENSMUST00000069168
AA Change: P231R
SMART Domains Protein: ENSMUSP00000068408
Gene: ENSMUSG00000055531
AA Change: P231R

DomainStartEndE-ValueType
RRM 82 157 8.79e-11 SMART
low complexity region 182 365 N/A INTRINSIC
low complexity region 376 400 N/A INTRINSIC
low complexity region 422 438 N/A INTRINSIC
low complexity region 489 551 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000175924
SMART Domains Protein: ENSMUSP00000135848
Gene: ENSMUSG00000055531

DomainStartEndE-ValueType
PDB:3Q2T|D 19 91 3e-48 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000176480
SMART Domains Protein: ENSMUSP00000135550
Gene: ENSMUSG00000055531

DomainStartEndE-ValueType
low complexity region 6 30 N/A INTRINSIC
low complexity region 52 68 N/A INTRINSIC
low complexity region 119 182 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176567
Predicted Effect unknown
Transcript: ENSMUST00000176670
AA Change: P231R
SMART Domains Protein: ENSMUSP00000135150
Gene: ENSMUSG00000055531
AA Change: P231R

DomainStartEndE-ValueType
RRM 82 157 8.79e-11 SMART
low complexity region 182 232 N/A INTRINSIC
low complexity region 273 402 N/A INTRINSIC
low complexity region 413 437 N/A INTRINSIC
low complexity region 459 475 N/A INTRINSIC
low complexity region 526 588 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000176686
AA Change: P231R
SMART Domains Protein: ENSMUSP00000134823
Gene: ENSMUSG00000055531
AA Change: P231R

DomainStartEndE-ValueType
RRM 82 157 8.79e-11 SMART
low complexity region 182 365 N/A INTRINSIC
low complexity region 376 400 N/A INTRINSIC
low complexity region 422 438 N/A INTRINSIC
low complexity region 489 552 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000177145
AA Change: P231R
SMART Domains Protein: ENSMUSP00000135136
Gene: ENSMUSG00000055531
AA Change: P231R

DomainStartEndE-ValueType
RRM 82 157 8.79e-11 SMART
low complexity region 182 365 N/A INTRINSIC
low complexity region 376 400 N/A INTRINSIC
low complexity region 422 438 N/A INTRINSIC
low complexity region 489 551 N/A INTRINSIC
Meta Mutation Damage Score 0.1046 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 99% (72/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one subunit of a cleavage factor required for 3' RNA cleavage and polyadenylation processing. The interaction of the protein with the RNA is one of the earliest steps in the assembly of the 3' end processing complex and facilitates the recruitment of other processing factors. The cleavage factor complex is composed of four polypeptides. This gene encodes the 68kD subunit. It has a domain organization reminiscent of spliceosomal proteins. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110025L11Rik A T 16: 89,063,765 Y60* probably null Het
2810403A07Rik T A 3: 88,696,606 H243Q probably benign Het
Abca6 T A 11: 110,244,295 E221D probably benign Het
Acyp2 C T 11: 30,506,354 E98K possibly damaging Het
Adi1 A G 12: 28,675,275 D8G probably benign Het
Adnp T C 2: 168,182,949 K809E possibly damaging Het
Aldh18a1 T C 19: 40,585,567 H4R probably benign Het
Atp6v0a1 T C 11: 101,038,807 S485P possibly damaging Het
C1galt1 T C 6: 7,864,143 probably null Het
Cacna2d4 A T 6: 119,239,054 N94I probably benign Het
Catsperg1 T C 7: 29,185,499 N899S probably damaging Het
Coro2a A G 4: 46,542,255 S373P probably damaging Het
Csmd3 A T 15: 47,633,703 N3099K probably damaging Het
Ctla2b T A 13: 60,896,132 E74D probably damaging Het
Dnah2 T A 11: 69,500,857 T671S probably benign Het
Drd5 T A 5: 38,320,905 S414T probably benign Het
Dyrk2 C T 10: 118,859,848 D502N probably damaging Het
Ecel1 A T 1: 87,152,876 L376Q possibly damaging Het
Efcab8 G A 2: 153,780,983 R24Q unknown Het
Eloc A C 1: 16,647,968 probably benign Het
Ep300 A G 15: 81,631,618 probably benign Het
Fam89b T C 19: 5,728,705 D152G probably damaging Het
Gm15455 G A 1: 33,836,846 noncoding transcript Het
Greb1l A G 18: 10,458,312 T30A probably benign Het
Hdac10 T C 15: 89,126,684 Y238C probably damaging Het
Ick A G 9: 78,160,715 T463A probably benign Het
Ighv2-5 T C 12: 113,685,882 T12A possibly damaging Het
Insrr T C 3: 87,810,700 probably null Het
Irf9 T C 14: 55,606,457 probably benign Het
Itpr2 A T 6: 146,376,155 C280* probably null Het
Kcnk18 T C 19: 59,219,839 C36R probably damaging Het
Klhl14 G T 18: 21,651,994 N125K probably benign Het
Lce1i T C 3: 92,777,735 S45G unknown Het
Lrmda A C 14: 22,027,306 D37A probably damaging Het
Marco A C 1: 120,485,854 D280E probably damaging Het
Miox C T 15: 89,336,247 Q180* probably null Het
Npdc1 A T 2: 25,408,670 M265L probably damaging Het
Nudcd3 T C 11: 6,113,274 K205R probably damaging Het
Olfr319 T A 11: 58,702,500 H266Q probably damaging Het
Olfr325 C G 11: 58,580,999 L52V possibly damaging Het
Pcdhga5 C T 18: 37,696,667 R723C probably benign Het
Pdlim5 T A 3: 142,259,186 E295D probably damaging Het
Poli C A 18: 70,517,428 E314* probably null Het
Ptpro A G 6: 137,380,224 N238D probably benign Het
R3hdm1 A G 1: 128,231,347 I920V probably benign Het
Ralgapa2 C T 2: 146,345,455 V1338M probably damaging Het
Saa3 T C 7: 46,712,661 Y53C probably damaging Het
Sept14 T A 5: 129,683,586 E398D probably benign Het
Six3 T C 17: 85,623,842 S309P possibly damaging Het
Slc7a14 A G 3: 31,257,770 S34P probably damaging Het
Smarca2 C A 19: 26,640,429 Q287K probably benign Het
Stard9 C T 2: 120,702,906 L522F possibly damaging Het
Sycp1 T C 3: 102,841,047 probably null Het
Tbc1d8 A T 1: 39,426,088 V73E probably damaging Het
Tldc1 T C 8: 119,772,418 I112V probably benign Het
Tmem120a T C 5: 135,736,250 probably null Het
Tsc2 T C 17: 24,600,396 E1251G possibly damaging Het
Vps51 T G 19: 6,071,033 E283D probably benign Het
Wnt5b A C 6: 119,440,433 L157R probably damaging Het
Zbtb24 T A 10: 41,464,582 V536E probably damaging Het
Zfp593 G A 4: 134,245,304 A67V probably benign Het
Zfp995 A T 17: 21,880,492 F254I probably benign Het
Other mutations in Cpsf6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00504:Cpsf6 APN 10 117366129 unclassified probably benign
IGL03018:Cpsf6 APN 10 117367956 missense probably benign 0.02
IGL03392:Cpsf6 APN 10 117367979 missense probably damaging 1.00
R1006:Cpsf6 UTSW 10 117366068 splice site probably benign
R1239:Cpsf6 UTSW 10 117361343 unclassified probably benign
R1611:Cpsf6 UTSW 10 117361828 intron probably benign
R2041:Cpsf6 UTSW 10 117359128 missense probably damaging 0.99
R2117:Cpsf6 UTSW 10 117366120 unclassified probably benign
R2225:Cpsf6 UTSW 10 117363036 unclassified probably benign
R4752:Cpsf6 UTSW 10 117361368 splice site probably benign
R5001:Cpsf6 UTSW 10 117367961 missense possibly damaging 0.71
R5176:Cpsf6 UTSW 10 117361284 unclassified probably benign
R5696:Cpsf6 UTSW 10 117361029 unclassified probably benign
R7216:Cpsf6 UTSW 10 117362023 missense unknown
R7226:Cpsf6 UTSW 10 117361822 missense unknown
R7522:Cpsf6 UTSW 10 117367829 missense unknown
Z1088:Cpsf6 UTSW 10 117356041 missense unknown
Predicted Primers PCR Primer
(F):5'- TATGCTGTGCCCCATATGCC -3'
(R):5'- TTTGGATGTTTGCAGCTACAC -3'

Sequencing Primer
(F):5'- ATGCCATGGAATCCTAGTTTCCAGG -3'
(R):5'- TTTGCAGCTACACAGTCAGG -3'
Posted On2017-06-05