Incidental Mutation 'R5312:Kbtbd11'
List |< first << previous [record 22 of 51] next >> last >|
ID478274
Institutional Source Beutler Lab
Gene Symbol Kbtbd11
Ensembl Gene ENSMUSG00000055675
Gene Namekelch repeat and BTB (POZ) domain containing 11
Synonyms4930465M17Rik, 2900016B01Rik
MMRRC Submission 042895-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R5312 (G1)
Quality Score40
Status Validated
Chromosome8
Chromosomal Location15011025-15033333 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 15028589 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 396 (D396G)
Ref Sequence ENSEMBL: ENSMUSP00000139292 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069399] [ENSMUST00000183471]
Predicted Effect possibly damaging
Transcript: ENSMUST00000069399
AA Change: D396G

PolyPhen 2 Score 0.924 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000068321
Gene: ENSMUSG00000055675
AA Change: D396G

DomainStartEndE-ValueType
low complexity region 61 73 N/A INTRINSIC
low complexity region 88 114 N/A INTRINSIC
BTB 146 237 1.74e-15 SMART
low complexity region 289 311 N/A INTRINSIC
Blast:BTB 318 358 2e-16 BLAST
Kelch 366 418 5.26e-3 SMART
Kelch 419 463 4.65e-4 SMART
Kelch 464 506 1.71e-1 SMART
low complexity region 524 532 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000183471
AA Change: D396G

PolyPhen 2 Score 0.924 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000139292
Gene: ENSMUSG00000055675
AA Change: D396G

DomainStartEndE-ValueType
low complexity region 61 73 N/A INTRINSIC
low complexity region 88 114 N/A INTRINSIC
BTB 146 237 1.74e-15 SMART
low complexity region 289 311 N/A INTRINSIC
Blast:BTB 318 358 2e-16 BLAST
Kelch 366 418 5.26e-3 SMART
Kelch 419 463 4.65e-4 SMART
Kelch 464 506 1.71e-1 SMART
low complexity region 524 532 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184243
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184598
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192473
Meta Mutation Damage Score 0.1074 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 100% (60/60)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624J02Rik T C 7: 118,813,576 I629T probably damaging Het
Abca15 T C 7: 120,345,369 V409A probably damaging Het
Abtb1 A G 6: 88,838,258 F297L probably damaging Het
Adam22 C A 5: 8,090,182 G202W probably damaging Het
Adgrg3 G A 8: 95,039,864 V388I probably benign Het
Adnp T C 2: 168,184,188 T396A probably benign Het
Ank2 T C 3: 126,959,768 Q288R probably damaging Het
Bdp1 T C 13: 100,097,601 probably null Het
Ccdc173 T C 2: 69,787,258 T60A possibly damaging Het
Cdc45 C T 16: 18,795,897 R205H probably damaging Het
Cntnap5c A T 17: 58,359,254 E1093V probably benign Het
Dmrta1 A C 4: 89,692,047 N415H probably damaging Het
Dnaaf5 T A 5: 139,152,862 V266E probably damaging Het
Dot1l A G 10: 80,784,637 Q511R possibly damaging Het
Ehmt1 A G 2: 24,884,195 V201A probably damaging Het
Fancg A G 4: 43,003,019 F613L probably benign Het
Fbxo10 A T 4: 45,042,036 I731N possibly damaging Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Gm5155 T G 7: 17,909,142 H492Q probably damaging Het
Gm6614 A T 6: 141,972,332 F606Y probably benign Het
Ighv1-74 A G 12: 115,802,881 S39P probably damaging Het
Klc1 A G 12: 111,795,621 K575R possibly damaging Het
Lman1l A T 9: 57,611,077 L343Q probably damaging Het
Mki67 A T 7: 135,700,830 V825E probably damaging Het
Mus81 T C 19: 5,483,494 K489R possibly damaging Het
Myog A G 1: 134,290,326 K91E probably damaging Het
Nfil3 A T 13: 52,967,620 V416E probably damaging Het
Nup160 G T 2: 90,732,832 E1314* probably null Het
Nwd2 C T 5: 63,806,072 Q1000* probably null Het
Olfr1277 T G 2: 111,270,310 D19A probably benign Het
Olfr1284 T C 2: 111,379,834 V278A possibly damaging Het
Olfr790 T A 10: 129,501,514 V210E probably damaging Het
Olfr792 A C 10: 129,541,265 M243L probably benign Het
Ppp4r4 T A 12: 103,606,888 probably null Het
Pramef25 A T 4: 143,949,095 I387N possibly damaging Het
Psg27 C A 7: 18,557,033 R415L probably benign Het
Ptprr T A 10: 116,188,419 S212T probably benign Het
Ramp3 T C 11: 6,674,888 F61L probably damaging Het
Rap1gds1 A G 3: 138,958,628 L322P probably damaging Het
Rnf5 A G 17: 34,601,588 F175S probably benign Het
Sema4a G A 3: 88,437,036 S636F probably damaging Het
Sfrp2 A G 3: 83,769,401 D193G probably damaging Het
Slc26a5 T C 5: 21,847,260 S24G probably damaging Het
Spg21 A G 9: 65,468,802 I31V probably benign Het
Tmem45a2 T C 16: 57,039,007 D287G possibly damaging Het
Utrn A T 10: 12,727,769 D627E probably damaging Het
Vmn2r103 A T 17: 19,793,034 N139I probably benign Het
Washc5 A T 15: 59,345,528 probably null Het
Zfp667 T C 7: 6,305,467 I378T probably benign Het
Zfp949 A C 9: 88,567,183 T14P possibly damaging Het
Other mutations in Kbtbd11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01151:Kbtbd11 APN 8 15029176 missense probably damaging 1.00
IGL02160:Kbtbd11 APN 8 15028801 missense probably damaging 1.00
IGL02538:Kbtbd11 APN 8 15028841 missense probably damaging 1.00
IGL03039:Kbtbd11 APN 8 15027467 missense probably benign 0.00
R0152:Kbtbd11 UTSW 8 15027428 missense probably damaging 0.96
R0242:Kbtbd11 UTSW 8 15027508 missense probably benign
R0242:Kbtbd11 UTSW 8 15027508 missense probably benign
R0453:Kbtbd11 UTSW 8 15027499 missense probably benign 0.01
R0498:Kbtbd11 UTSW 8 15027605 missense probably benign
R0629:Kbtbd11 UTSW 8 15027572 missense probably benign
R2031:Kbtbd11 UTSW 8 15028021 missense possibly damaging 0.87
R2214:Kbtbd11 UTSW 8 15029178 missense possibly damaging 0.85
R3720:Kbtbd11 UTSW 8 15029118 nonsense probably null
R3722:Kbtbd11 UTSW 8 15029118 nonsense probably null
R4355:Kbtbd11 UTSW 8 15028578 missense probably damaging 1.00
R4658:Kbtbd11 UTSW 8 15028917 missense possibly damaging 0.59
R5037:Kbtbd11 UTSW 8 15027886 missense probably benign 0.25
R5936:Kbtbd11 UTSW 8 15027534 missense probably benign 0.00
R6056:Kbtbd11 UTSW 8 15027577 missense probably benign
R6272:Kbtbd11 UTSW 8 15029118 nonsense probably null
R6547:Kbtbd11 UTSW 8 15027641 missense possibly damaging 0.83
R7126:Kbtbd11 UTSW 8 15028759 missense probably damaging 1.00
R7359:Kbtbd11 UTSW 8 15028858 missense probably damaging 1.00
Z1088:Kbtbd11 UTSW 8 15027839 missense probably damaging 1.00
Z1177:Kbtbd11 UTSW 8 15027694 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- CGTTTATTGCTACCAGGCGGAG -3'
(R):5'- AATCTCTCCGTTACAGGTGGC -3'

Sequencing Primer
(F):5'- TTCAACTACCTCTTCCTGGCGG -3'
(R):5'- TTACAGGTGGCAGCCTCGTG -3'
Posted On2017-06-09