Incidental Mutation 'R5277:Tmem63c'
ID478301
Institutional Source Beutler Lab
Gene Symbol Tmem63c
Ensembl Gene ENSMUSG00000034145
Gene Nametransmembrane protein 63c
Synonyms9330187M14Rik
MMRRC Submission 042864-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock #R5277 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location87021340-87090043 bp(+) (GRCm38)
Type of Mutationunclassified (87 bp from exon)
DNA Base Change (assembly) T to A at 87057757 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000122346 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110187] [ENSMUST00000131878] [ENSMUST00000146292] [ENSMUST00000154801] [ENSMUST00000156162]
Predicted Effect probably benign
Transcript: ENSMUST00000110187
SMART Domains Protein: ENSMUSP00000105816
Gene: ENSMUSG00000034145

DomainStartEndE-ValueType
Pfam:RSN1_TM 35 204 9.5e-21 PFAM
Pfam:DUF4463 253 323 6.1e-16 PFAM
Pfam:DUF221 341 680 8.9e-89 PFAM
transmembrane domain 682 704 N/A INTRINSIC
low complexity region 728 737 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131878
SMART Domains Protein: ENSMUSP00000117023
Gene: ENSMUSG00000034145

DomainStartEndE-ValueType
Pfam:RSN1_TM 35 204 9.5e-21 PFAM
Pfam:DUF4463 253 323 6.1e-16 PFAM
Pfam:DUF221 341 680 8.9e-89 PFAM
transmembrane domain 682 704 N/A INTRINSIC
low complexity region 728 737 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000146292
SMART Domains Protein: ENSMUSP00000119872
Gene: ENSMUSG00000034145

DomainStartEndE-ValueType
Pfam:RSN1_TM 35 204 1.6e-20 PFAM
Pfam:PHM7_cyt 253 323 6e-12 PFAM
Pfam:RSN1_7TM 341 680 2.5e-88 PFAM
transmembrane domain 682 704 N/A INTRINSIC
low complexity region 728 737 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000154801
SMART Domains Protein: ENSMUSP00000119898
Gene: ENSMUSG00000034145

DomainStartEndE-ValueType
Pfam:RSN1_TM 35 179 1.6e-16 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000156162
SMART Domains Protein: ENSMUSP00000122346
Gene: ENSMUSG00000034145

DomainStartEndE-ValueType
transmembrane domain 35 57 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 98% (52/53)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi1 T C 2: 22,994,648 T54A probably damaging Het
Ablim1 T C 19: 57,155,261 R89G probably damaging Het
Bco1 T A 8: 117,117,389 probably null Het
Bhmt A T 13: 93,624,885 M185K possibly damaging Het
Camk2d T C 3: 126,684,741 probably benign Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Het
Dcaf6 A G 1: 165,424,346 S70P probably benign Het
Dclre1a C T 19: 56,544,732 V477I possibly damaging Het
Dnah10 C T 5: 124,828,137 P4021L probably damaging Het
Dusp10 A G 1: 184,037,007 N57D possibly damaging Het
Fam13b G A 18: 34,462,190 R374C probably benign Het
Fyb2 G A 4: 105,015,679 D686N probably damaging Het
Glra3 G A 8: 55,991,207 M67I possibly damaging Het
Gm14325 G A 2: 177,832,984 H102Y possibly damaging Het
Gm6180 A G 8: 42,247,140 noncoding transcript Het
Grin2c A G 11: 115,253,813 V629A probably damaging Het
Kif4-ps A T 12: 101,145,927 noncoding transcript Het
Mc3r T C 2: 172,249,787 F310L probably damaging Het
Myh4 A G 11: 67,252,354 D1036G probably damaging Het
Myh6 A G 14: 54,956,562 I790T probably benign Het
Myo15 C A 11: 60,477,114 Y233* probably null Het
Nckap5 A T 1: 126,026,540 C758* probably null Het
Neurog3 T A 10: 62,133,853 Y36N probably damaging Het
Nlrp4e T C 7: 23,321,438 L450P probably benign Het
Olfr607 A T 7: 103,460,941 L84H probably damaging Het
Otog A G 7: 46,246,621 E170G possibly damaging Het
Ppp2r2b G T 18: 42,741,142 T41K probably damaging Het
Prmt5 A T 14: 54,509,942 D459E probably benign Het
Ric8b G A 10: 84,947,652 V125M probably damaging Het
Rptor A G 11: 119,822,956 S4G probably damaging Het
Rslcan18 T G 13: 67,098,434 E371D probably benign Het
Scaf11 A T 15: 96,419,226 F819Y probably damaging Het
Sema6a A T 18: 47,276,544 probably benign Het
Snx29 C T 16: 11,399,824 T163I possibly damaging Het
Sphkap T C 1: 83,276,164 N1288S probably benign Het
Tmbim7 G A 5: 3,673,192 probably null Het
Tmem69 A G 4: 116,553,261 F171L probably benign Het
Urod A T 4: 116,990,285 probably benign Het
Vmn1r37 A T 6: 66,731,476 I29L probably benign Het
Vmn2r102 A G 17: 19,694,131 T653A possibly damaging Het
Vmn2r75 A C 7: 86,166,292 S121R probably benign Het
Vwde T C 6: 13,186,996 T831A probably benign Het
Wdr70 C T 15: 7,976,984 W362* probably null Het
Zfat A G 15: 68,165,909 C906R probably damaging Het
Zfp7 T C 15: 76,881,203 V32A probably damaging Het
Other mutations in Tmem63c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00730:Tmem63c APN 12 87077206 missense probably benign 0.05
IGL00837:Tmem63c APN 12 87077197 missense probably benign
IGL01317:Tmem63c APN 12 87071996 splice site probably benign
IGL01521:Tmem63c APN 12 87069144 missense probably damaging 0.99
IGL01955:Tmem63c APN 12 87077208 missense probably benign 0.00
IGL02007:Tmem63c APN 12 87072873 missense probably damaging 1.00
IGL02891:Tmem63c APN 12 87071268 missense probably benign 0.00
IGL03102:Tmem63c APN 12 87065549 missense probably benign 0.42
IGL03273:Tmem63c APN 12 87081802 missense probably damaging 1.00
R0238:Tmem63c UTSW 12 87075639 missense probably damaging 1.00
R0238:Tmem63c UTSW 12 87075639 missense probably damaging 1.00
R0239:Tmem63c UTSW 12 87075639 missense probably damaging 1.00
R0239:Tmem63c UTSW 12 87075639 missense probably damaging 1.00
R0975:Tmem63c UTSW 12 87075069 splice site probably benign
R2398:Tmem63c UTSW 12 87056533 missense probably damaging 1.00
R4416:Tmem63c UTSW 12 87081902 missense probably benign 0.14
R4721:Tmem63c UTSW 12 87057180 missense possibly damaging 0.70
R4881:Tmem63c UTSW 12 87086418 missense possibly damaging 0.67
R4888:Tmem63c UTSW 12 87089365 missense probably damaging 1.00
R5210:Tmem63c UTSW 12 87089398 missense probably benign 0.10
R5790:Tmem63c UTSW 12 87057636 missense probably benign 0.10
R5855:Tmem63c UTSW 12 87075726 missense probably damaging 1.00
R5940:Tmem63c UTSW 12 87075172 missense probably benign
R6000:Tmem63c UTSW 12 87057197 missense probably damaging 1.00
R6240:Tmem63c UTSW 12 87076405 missense possibly damaging 0.67
R6268:Tmem63c UTSW 12 87081953 missense probably damaging 1.00
R6749:Tmem63c UTSW 12 87075665 missense probably damaging 1.00
R7380:Tmem63c UTSW 12 87077948 missense probably benign 0.00
R7472:Tmem63c UTSW 12 87069158 missense possibly damaging 0.50
Predicted Primers PCR Primer
(F):5'- CACCTAGAGAACCTATAGGGAGC -3'
(R):5'- GCAACGTCAGAAGTCCACAG -3'

Sequencing Primer
(F):5'- AGGTGCCTGAGAACCTAGTCTCTC -3'
(R):5'- GCAACGTCAGAAGTCCACAGAAAAG -3'
Posted On2017-06-21