Incidental Mutation 'R5447:Nfxl1'
ID478315
Institutional Source Beutler Lab
Gene Symbol Nfxl1
Ensembl Gene ENSMUSG00000072889
Gene Namenuclear transcription factor, X-box binding-like 1
Synonyms1700012H24Rik, TCF9, D430033A06Rik, LOC381696
MMRRC Submission 043012-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.256) question?
Stock #R5447 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location72513301-72559684 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 72529169 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 563 (R563Q)
Ref Sequence ENSEMBL: ENSMUSP00000084467 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087216] [ENSMUST00000135318]
Predicted Effect probably benign
Transcript: ENSMUST00000087216
AA Change: R563Q

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000084467
Gene: ENSMUSG00000072889
AA Change: R563Q

DomainStartEndE-ValueType
low complexity region 9 19 N/A INTRINSIC
low complexity region 25 64 N/A INTRINSIC
low complexity region 106 125 N/A INTRINSIC
low complexity region 134 142 N/A INTRINSIC
RING 167 226 4.99e-1 SMART
ZnF_NFX 272 290 2.83e-3 SMART
ZnF_NFX 325 344 1.42e-3 SMART
ZnF_NFX 378 397 2.88e-4 SMART
ZnF_NFX 431 450 5.01e-4 SMART
ZnF_NFX 458 479 1.67e2 SMART
ZnF_NFX 483 502 9.71e-2 SMART
ZnF_NFX 510 529 3.49e-3 SMART
ZnF_NFX 567 587 4.56e1 SMART
Pfam:zf-NF-X1 596 608 6.8e-3 PFAM
ZnF_NFX 677 710 4.23e1 SMART
ZnF_NFX 720 738 5.49e-1 SMART
ZnF_NFX 782 801 1.63e-3 SMART
coiled coil region 829 880 N/A INTRINSIC
transmembrane domain 897 914 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000135318
SMART Domains Protein: ENSMUSP00000114355
Gene: ENSMUSG00000072889

DomainStartEndE-ValueType
low complexity region 9 19 N/A INTRINSIC
low complexity region 25 64 N/A INTRINSIC
low complexity region 106 125 N/A INTRINSIC
low complexity region 134 142 N/A INTRINSIC
RING 167 226 4.99e-1 SMART
ZnF_NFX 272 290 2.83e-3 SMART
ZnF_NFX 325 344 1.42e-3 SMART
ZnF_NFX 378 397 2.88e-4 SMART
ZnF_NFX 431 450 5.01e-4 SMART
ZnF_NFX 458 479 1.67e2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153882
Meta Mutation Damage Score 0.0730 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 97% (71/73)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830473C10Rik C A 5: 90,584,310 A458E probably damaging Het
Abcb5 T C 12: 118,927,326 I479V probably damaging Het
Adam30 A G 3: 98,161,343 D164G probably benign Het
Adgrl3 T A 5: 81,465,341 probably benign Het
Adrb1 T C 19: 56,723,087 I239T probably benign Het
B4galnt3 T C 6: 120,215,057 T572A probably benign Het
Baz2b T C 2: 59,913,988 E1391G probably damaging Het
BC016579 A G 16: 45,648,889 V72A probably benign Het
Btnl10 A T 11: 58,922,318 I258F probably benign Het
Cdh5 A T 8: 104,129,362 D309V probably damaging Het
Cdhr2 A G 13: 54,733,250 D1042G probably damaging Het
Clk2 G T 3: 89,167,191 V53F possibly damaging Het
Cyfip2 T C 11: 46,291,586 D15G possibly damaging Het
Dip2b C T 15: 100,211,986 R1451C probably damaging Het
Dmbt1 A G 7: 131,119,511 Y1836C probably damaging Het
Dysf T C 6: 84,195,263 F1905L probably damaging Het
E130114P18Rik A G 4: 97,690,718 S7P unknown Het
Fam110a T C 2: 151,970,709 E47G probably damaging Het
Gemin6 T G 17: 80,227,749 V46G probably damaging Het
H2-Ke6 A T 17: 34,026,912 V202D probably damaging Het
Helb T A 10: 120,102,901 D556V possibly damaging Het
Hoxd4 A G 2: 74,727,343 E22G probably damaging Het
Il1rl2 T G 1: 40,329,156 I162R probably damaging Het
Lhfpl5 A G 17: 28,576,097 T33A probably damaging Het
Mapk8ip3 G A 17: 24,899,189 A1283V probably benign Het
Mettl13 A G 1: 162,535,880 V227A probably benign Het
Mmgt2 T A 11: 62,664,998 C57* probably null Het
Muc4 G C 16: 32,753,919 R1265P probably benign Het
Mylk2 T C 2: 152,912,510 S175P probably damaging Het
Neu4 C T 1: 94,022,418 T33M probably damaging Het
Nfs1 C T 2: 156,142,136 R107H probably benign Het
Nid1 A G 13: 13,437,910 D70G probably benign Het
Nup160 C A 2: 90,725,615 Q1220K possibly damaging Het
Olfr175-ps1 A T 16: 58,824,483 C75* probably null Het
Olfr381 A G 11: 73,486,176 V216A probably benign Het
Olfr51 G A 11: 51,007,343 V124M possibly damaging Het
Olfr605 A C 7: 103,442,940 M61R probably damaging Het
Pdgfrb T A 18: 61,068,108 V422E probably damaging Het
Pear1 G A 3: 87,759,142 R85C probably damaging Het
Pkhd1 T A 1: 20,239,385 M2780L probably benign Het
Ppp4r4 T C 12: 103,584,151 V62A possibly damaging Het
Prol1 C T 5: 88,328,266 P172S unknown Het
Proz A G 8: 13,072,578 I231V probably benign Het
Ptch1 T G 13: 63,527,245 M718L probably benign Het
Ptprs A G 17: 56,429,128 C102R possibly damaging Het
Robo2 A T 16: 73,973,766 Y490* probably null Het
Rptor G A 11: 119,843,713 G514D probably damaging Het
Scara5 CG C 14: 65,759,662 probably null Het
Skint6 T A 4: 113,105,909 S442C probably benign Het
Snw1 T C 12: 87,455,715 E303G probably benign Het
Sp110 C G 1: 85,589,118 E219D probably damaging Het
Stam2 G A 2: 52,736,293 probably benign Het
Stk10 C T 11: 32,604,166 Q618* probably null Het
Tmc3 A T 7: 83,622,361 E907V possibly damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ttn T A 2: 76,899,107 probably benign Het
Vps39 T C 2: 120,352,932 D19G probably benign Het
Zan T C 5: 137,472,191 S229G probably damaging Het
Zfp141 A T 7: 42,475,559 C496* probably null Het
Zgrf1 T C 3: 127,563,119 S665P possibly damaging Het
Other mutations in Nfxl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01094:Nfxl1 APN 5 72550428 splice site probably benign
IGL01716:Nfxl1 APN 5 72540934 missense probably damaging 1.00
IGL02592:Nfxl1 APN 5 72514229 missense probably benign 0.25
IGL03083:Nfxl1 APN 5 72540662 splice site probably benign
FR4548:Nfxl1 UTSW 5 72559115 small insertion probably benign
FR4737:Nfxl1 UTSW 5 72559121 small insertion probably benign
R0478:Nfxl1 UTSW 5 72524645 critical splice donor site probably null
R0725:Nfxl1 UTSW 5 72559130 missense probably benign
R1374:Nfxl1 UTSW 5 72524145 missense probably benign 0.04
R1616:Nfxl1 UTSW 5 72529037 missense probably benign 0.01
R1752:Nfxl1 UTSW 5 72540875 missense probably damaging 1.00
R2108:Nfxl1 UTSW 5 72514332 critical splice acceptor site probably null
R3081:Nfxl1 UTSW 5 72529035 missense possibly damaging 0.92
R3693:Nfxl1 UTSW 5 72540611 missense probably damaging 0.99
R3725:Nfxl1 UTSW 5 72517062 missense probably damaging 1.00
R4660:Nfxl1 UTSW 5 72552668 missense probably damaging 1.00
R5058:Nfxl1 UTSW 5 72556239 missense probably benign 0.03
R5406:Nfxl1 UTSW 5 72556198 missense possibly damaging 0.92
R5634:Nfxl1 UTSW 5 72529490 missense probably damaging 1.00
R5831:Nfxl1 UTSW 5 72522197 missense probably benign
R5910:Nfxl1 UTSW 5 72540365 missense probably benign 0.05
R6086:Nfxl1 UTSW 5 72541019 missense probably benign 0.39
R6091:Nfxl1 UTSW 5 72514190 missense probably benign 0.00
R6212:Nfxl1 UTSW 5 72516210 critical splice donor site probably null
R6501:Nfxl1 UTSW 5 72528509 unclassified probably null
R6521:Nfxl1 UTSW 5 72540308 unclassified probably null
R7283:Nfxl1 UTSW 5 72529050 missense probably benign
R7426:Nfxl1 UTSW 5 72524174 nonsense probably null
R7480:Nfxl1 UTSW 5 72559252 nonsense probably null
R7648:Nfxl1 UTSW 5 72523536 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- TAACAACACTGTCCTTACCCTG -3'
(R):5'- CAAAGAGCTGTGCAGGTTGG -3'

Sequencing Primer
(F):5'- GCCAGTCTGCTTTACTAATGC -3'
(R):5'- GTTGGTATGAAGCATTCCACAGCC -3'
Posted On2017-06-23