Incidental Mutation 'R5447:Dip2b'
ID 478316
Institutional Source Beutler Lab
Gene Symbol Dip2b
Ensembl Gene ENSMUSG00000023026
Gene Name disco interacting protein 2 homolog B
Synonyms
MMRRC Submission 043012-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.615) question?
Stock # R5447 (G1)
Quality Score 225
Status Validated
Chromosome 15
Chromosomal Location 99936545-100117354 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 100109867 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Cysteine at position 1451 (R1451C)
Ref Sequence ENSEMBL: ENSMUSP00000097777 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023768] [ENSMUST00000100203] [ENSMUST00000108971]
AlphaFold Q3UH60
Predicted Effect possibly damaging
Transcript: ENSMUST00000023768
AA Change: R1217C

PolyPhen 2 Score 0.886 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000023768
Gene: ENSMUSG00000023026
AA Change: R1217C

DomainStartEndE-ValueType
Pfam:AMP-binding 109 584 9.5e-26 PFAM
Pfam:AMP-binding 760 1235 1.2e-52 PFAM
low complexity region 1299 1311 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000100203
AA Change: R1451C

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000097777
Gene: ENSMUSG00000023026
AA Change: R1451C

DomainStartEndE-ValueType
DMAP_binding 12 130 1e-42 SMART
low complexity region 152 168 N/A INTRINSIC
low complexity region 181 192 N/A INTRINSIC
Pfam:AMP-binding 341 817 2e-26 PFAM
Pfam:AMP-binding 993 1468 1.8e-64 PFAM
low complexity region 1532 1544 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000108971
AA Change: R1217C

PolyPhen 2 Score 0.886 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000104599
Gene: ENSMUSG00000023026
AA Change: R1217C

DomainStartEndE-ValueType
Pfam:AMP-binding 108 583 9.5e-26 PFAM
Pfam:AMP-binding 759 1234 1.2e-52 PFAM
low complexity region 1298 1310 N/A INTRINSIC
Meta Mutation Damage Score 0.2571 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 97% (71/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the disco-interacting protein homolog 2 protein family. The encoded protein contains a binding site for the transcriptional regulator DNA methyltransferase 1 associated protein 1 as well as AMP-binding sites. The presence of these sites suggests that the encoded protein may participate in DNA methylation. This gene is located near a folate-sensitive fragile site, and CGG-repeat expansion in the promoter of this gene which affects transcription has been detected in individuals containing this fragile site on chromosome 12. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 T C 12: 118,891,061 (GRCm39) I479V probably damaging Het
Adam30 A G 3: 98,068,659 (GRCm39) D164G probably benign Het
Adgrl3 T A 5: 81,613,188 (GRCm39) probably benign Het
Adrb1 T C 19: 56,711,519 (GRCm39) I239T probably benign Het
Albfm1 C A 5: 90,732,169 (GRCm39) A458E probably damaging Het
B4galnt3 T C 6: 120,192,018 (GRCm39) T572A probably benign Het
Baz2b T C 2: 59,744,332 (GRCm39) E1391G probably damaging Het
BC016579 A G 16: 45,469,252 (GRCm39) V72A probably benign Het
Btnl10 A T 11: 58,813,144 (GRCm39) I258F probably benign Het
Cdh5 A T 8: 104,855,994 (GRCm39) D309V probably damaging Het
Cdhr2 A G 13: 54,881,063 (GRCm39) D1042G probably damaging Het
Clk2 G T 3: 89,074,498 (GRCm39) V53F possibly damaging Het
Cyfip2 T C 11: 46,182,413 (GRCm39) D15G possibly damaging Het
Dmbt1 A G 7: 130,721,240 (GRCm39) Y1836C probably damaging Het
Dysf T C 6: 84,172,245 (GRCm39) F1905L probably damaging Het
E130114P18Rik A G 4: 97,578,955 (GRCm39) S7P unknown Het
Fam110a T C 2: 151,812,629 (GRCm39) E47G probably damaging Het
Gemin6 T G 17: 80,535,178 (GRCm39) V46G probably damaging Het
Helb T A 10: 119,938,806 (GRCm39) D556V possibly damaging Het
Hoxd4 A G 2: 74,557,687 (GRCm39) E22G probably damaging Het
Hsd17b8 A T 17: 34,245,886 (GRCm39) V202D probably damaging Het
Il1rl2 T G 1: 40,368,316 (GRCm39) I162R probably damaging Het
Lhfpl5 A G 17: 28,795,071 (GRCm39) T33A probably damaging Het
Mapk8ip3 G A 17: 25,118,163 (GRCm39) A1283V probably benign Het
Mettl13 A G 1: 162,363,449 (GRCm39) V227A probably benign Het
Mmgt2 T A 11: 62,555,824 (GRCm39) C57* probably null Het
Muc4 G C 16: 32,753,919 (GRCm38) R1265P probably benign Het
Mylk2 T C 2: 152,754,430 (GRCm39) S175P probably damaging Het
Neu4 C T 1: 93,950,140 (GRCm39) T33M probably damaging Het
Nfs1 C T 2: 155,984,056 (GRCm39) R107H probably benign Het
Nfxl1 C T 5: 72,686,512 (GRCm39) R563Q probably benign Het
Nid1 A G 13: 13,612,495 (GRCm39) D70G probably benign Het
Nup160 C A 2: 90,555,959 (GRCm39) Q1220K possibly damaging Het
Or1ad8 G A 11: 50,898,170 (GRCm39) V124M possibly damaging Het
Or1e22 A G 11: 73,377,002 (GRCm39) V216A probably benign Het
Or52s6 A C 7: 103,092,147 (GRCm39) M61R probably damaging Het
Or5k8 A T 16: 58,644,846 (GRCm39) C75* probably null Het
Pdgfrb T A 18: 61,201,180 (GRCm39) V422E probably damaging Het
Pear1 G A 3: 87,666,449 (GRCm39) R85C probably damaging Het
Pkhd1 T A 1: 20,309,609 (GRCm39) M2780L probably benign Het
Ppp4r4 T C 12: 103,550,410 (GRCm39) V62A possibly damaging Het
Prol1 C T 5: 88,476,125 (GRCm39) P172S unknown Het
Proz A G 8: 13,122,578 (GRCm39) I231V probably benign Het
Ptch1 T G 13: 63,675,059 (GRCm39) M718L probably benign Het
Ptprs A G 17: 56,736,128 (GRCm39) C102R possibly damaging Het
Robo2 A T 16: 73,770,654 (GRCm39) Y490* probably null Het
Rptor G A 11: 119,734,539 (GRCm39) G514D probably damaging Het
Scara5 CG C 14: 65,997,111 (GRCm39) probably null Het
Skint6 T A 4: 112,963,106 (GRCm39) S442C probably benign Het
Snw1 T C 12: 87,502,485 (GRCm39) E303G probably benign Het
Sp110 C G 1: 85,516,839 (GRCm39) E219D probably damaging Het
Stam2 G A 2: 52,626,305 (GRCm39) probably benign Het
Stk10 C T 11: 32,554,166 (GRCm39) Q618* probably null Het
Tmc3 A T 7: 83,271,569 (GRCm39) E907V possibly damaging Het
Ttn A T 2: 76,641,587 (GRCm39) L5176Q possibly damaging Het
Ttn T A 2: 76,729,451 (GRCm39) probably benign Het
Vps39 T C 2: 120,183,413 (GRCm39) D19G probably benign Het
Zan T C 5: 137,470,453 (GRCm39) S229G probably damaging Het
Zfp141 A T 7: 42,124,983 (GRCm39) C496* probably null Het
Zgrf1 T C 3: 127,356,768 (GRCm39) S665P possibly damaging Het
Other mutations in Dip2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00515:Dip2b APN 15 100,072,382 (GRCm39) missense probably damaging 1.00
IGL01716:Dip2b APN 15 100,107,517 (GRCm39) missense probably benign 0.00
IGL01893:Dip2b APN 15 100,069,101 (GRCm39) splice site probably benign
IGL01915:Dip2b APN 15 100,076,392 (GRCm39) missense probably damaging 1.00
IGL02125:Dip2b APN 15 100,084,131 (GRCm39) missense possibly damaging 0.60
IGL02200:Dip2b APN 15 100,049,083 (GRCm39) missense possibly damaging 0.93
IGL02506:Dip2b APN 15 100,055,162 (GRCm39) missense probably damaging 1.00
IGL02571:Dip2b APN 15 100,055,766 (GRCm39) missense possibly damaging 0.93
IGL02706:Dip2b APN 15 100,113,192 (GRCm39) missense probably damaging 0.98
IGL02983:Dip2b APN 15 100,029,903 (GRCm39) missense possibly damaging 0.81
IGL03120:Dip2b APN 15 100,101,008 (GRCm39) splice site probably benign
IGL03181:Dip2b APN 15 100,113,088 (GRCm39) missense probably damaging 0.98
IGL03229:Dip2b APN 15 100,105,719 (GRCm39) splice site probably benign
IGL03399:Dip2b APN 15 100,073,208 (GRCm39) missense possibly damaging 0.63
PIT4131001:Dip2b UTSW 15 100,100,233 (GRCm39) missense probably damaging 1.00
R0009:Dip2b UTSW 15 100,067,193 (GRCm39) missense probably damaging 1.00
R0058:Dip2b UTSW 15 100,113,121 (GRCm39) missense probably benign 0.03
R0058:Dip2b UTSW 15 100,113,121 (GRCm39) missense probably benign 0.03
R0092:Dip2b UTSW 15 100,100,146 (GRCm39) missense probably damaging 1.00
R0201:Dip2b UTSW 15 100,084,028 (GRCm39) missense probably damaging 0.98
R0359:Dip2b UTSW 15 100,109,874 (GRCm39) missense probably damaging 0.98
R0390:Dip2b UTSW 15 100,091,794 (GRCm39) missense probably damaging 0.99
R0564:Dip2b UTSW 15 100,060,600 (GRCm39) nonsense probably null
R0730:Dip2b UTSW 15 100,069,532 (GRCm39) missense probably damaging 1.00
R1144:Dip2b UTSW 15 100,052,131 (GRCm39) missense probably benign 0.11
R1200:Dip2b UTSW 15 100,107,626 (GRCm39) missense probably benign 0.00
R1506:Dip2b UTSW 15 100,080,994 (GRCm39) missense probably damaging 1.00
R1750:Dip2b UTSW 15 100,076,347 (GRCm39) missense probably benign
R1760:Dip2b UTSW 15 100,109,910 (GRCm39) missense probably damaging 1.00
R1773:Dip2b UTSW 15 100,091,842 (GRCm39) missense probably benign 0.00
R1812:Dip2b UTSW 15 100,096,819 (GRCm39) splice site probably null
R2264:Dip2b UTSW 15 100,101,097 (GRCm39) missense probably benign 0.05
R3105:Dip2b UTSW 15 100,040,018 (GRCm39) nonsense probably null
R4029:Dip2b UTSW 15 100,084,053 (GRCm39) missense probably damaging 1.00
R4030:Dip2b UTSW 15 100,084,053 (GRCm39) missense probably damaging 1.00
R4296:Dip2b UTSW 15 100,079,217 (GRCm39) missense probably benign
R4392:Dip2b UTSW 15 100,059,917 (GRCm39) missense probably damaging 1.00
R4480:Dip2b UTSW 15 100,084,182 (GRCm39) missense probably damaging 0.99
R4564:Dip2b UTSW 15 100,055,139 (GRCm39) nonsense probably null
R4605:Dip2b UTSW 15 100,107,517 (GRCm39) missense probably benign 0.00
R4606:Dip2b UTSW 15 100,113,210 (GRCm39) missense possibly damaging 0.91
R4634:Dip2b UTSW 15 100,058,372 (GRCm39) missense probably damaging 1.00
R4667:Dip2b UTSW 15 100,049,241 (GRCm39) missense probably benign 0.01
R4739:Dip2b UTSW 15 100,105,658 (GRCm39) missense probably damaging 0.98
R4826:Dip2b UTSW 15 100,067,162 (GRCm39) missense probably damaging 0.99
R4870:Dip2b UTSW 15 100,093,665 (GRCm39) splice site probably null
R4877:Dip2b UTSW 15 100,058,410 (GRCm39) missense possibly damaging 0.49
R4932:Dip2b UTSW 15 100,069,603 (GRCm39) missense probably damaging 1.00
R5009:Dip2b UTSW 15 100,093,665 (GRCm39) splice site probably null
R5169:Dip2b UTSW 15 100,102,994 (GRCm39) missense probably damaging 1.00
R5216:Dip2b UTSW 15 100,109,867 (GRCm39) missense probably damaging 1.00
R5218:Dip2b UTSW 15 100,052,177 (GRCm39) missense probably benign 0.00
R5274:Dip2b UTSW 15 100,109,985 (GRCm39) missense possibly damaging 0.54
R5370:Dip2b UTSW 15 100,109,867 (GRCm39) missense probably damaging 1.00
R5420:Dip2b UTSW 15 100,103,054 (GRCm39) intron probably benign
R5670:Dip2b UTSW 15 100,087,985 (GRCm39) missense possibly damaging 0.80
R5768:Dip2b UTSW 15 100,055,826 (GRCm39) missense probably benign 0.32
R5908:Dip2b UTSW 15 100,049,065 (GRCm39) missense possibly damaging 0.93
R5957:Dip2b UTSW 15 100,107,575 (GRCm39) missense probably benign 0.03
R5987:Dip2b UTSW 15 100,087,960 (GRCm39) missense probably damaging 1.00
R6260:Dip2b UTSW 15 100,060,583 (GRCm39) missense probably benign 0.05
R6325:Dip2b UTSW 15 100,052,163 (GRCm39) missense probably benign 0.00
R6367:Dip2b UTSW 15 100,013,795 (GRCm39) missense possibly damaging 0.50
R6391:Dip2b UTSW 15 100,049,157 (GRCm39) missense probably damaging 1.00
R6422:Dip2b UTSW 15 100,096,892 (GRCm39) missense probably damaging 0.98
R6818:Dip2b UTSW 15 100,091,835 (GRCm39) missense probably benign 0.09
R6922:Dip2b UTSW 15 100,091,724 (GRCm39) missense probably benign 0.25
R7002:Dip2b UTSW 15 100,058,346 (GRCm39) missense probably benign 0.43
R7076:Dip2b UTSW 15 100,055,853 (GRCm39) splice site probably null
R7176:Dip2b UTSW 15 100,067,199 (GRCm39) missense probably damaging 1.00
R7255:Dip2b UTSW 15 100,107,508 (GRCm39) missense probably benign 0.00
R7463:Dip2b UTSW 15 100,052,038 (GRCm39) missense probably benign
R7513:Dip2b UTSW 15 100,105,629 (GRCm39) splice site probably null
R7876:Dip2b UTSW 15 100,088,922 (GRCm39) missense probably benign 0.02
R8368:Dip2b UTSW 15 100,052,124 (GRCm39) missense probably benign 0.00
R9289:Dip2b UTSW 15 100,071,152 (GRCm39) missense probably damaging 0.97
R9405:Dip2b UTSW 15 100,093,757 (GRCm39) missense probably benign 0.05
R9477:Dip2b UTSW 15 99,936,784 (GRCm39) missense probably damaging 1.00
R9485:Dip2b UTSW 15 100,052,924 (GRCm39) missense probably benign 0.05
R9533:Dip2b UTSW 15 100,073,178 (GRCm39) missense probably benign 0.06
R9581:Dip2b UTSW 15 100,079,255 (GRCm39) missense probably damaging 0.99
R9666:Dip2b UTSW 15 100,107,461 (GRCm39) missense probably damaging 1.00
X0064:Dip2b UTSW 15 100,013,731 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTCACCTACGAAGCCATCCTC -3'
(R):5'- GCCGACTGACCAGAACAATTTTC -3'

Sequencing Primer
(F):5'- AGACTCAGTGATGTGTCCCTCATAG -3'
(R):5'- GACTGACCAGAACAATTTTCATCATC -3'
Posted On 2017-06-23