Incidental Mutation 'R5450:Lrguk'
ID 478321
Institutional Source Beutler Lab
Gene Symbol Lrguk
Ensembl Gene ENSMUSG00000056215
Gene Name leucine-rich repeats and guanylate kinase domain containing
Synonyms 4921528H16Rik
MMRRC Submission 043015-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.094) question?
Stock # R5450 (G1)
Quality Score 184
Status Validated
Chromosome 6
Chromosomal Location 34006379-34110969 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 34047996 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 314 (I314F)
Ref Sequence ENSEMBL: ENSMUSP00000153993 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070189] [ENSMUST00000228187]
AlphaFold Q9D5S7
Predicted Effect probably damaging
Transcript: ENSMUST00000070189
AA Change: I314F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000065146
Gene: ENSMUSG00000056215
AA Change: I314F

DomainStartEndE-ValueType
coiled coil region 75 113 N/A INTRINSIC
LRR 148 170 2.69e2 SMART
LRR 236 258 1.86e2 SMART
LRR 279 301 1.99e0 SMART
LRR 326 349 1.58e2 SMART
GuKc 414 600 6.84e-18 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000228187
AA Change: I314F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Meta Mutation Damage Score 0.3295 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 97% (74/76)
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930505A04Rik C T 11: 30,376,349 (GRCm39) V173M probably damaging Het
Arhgef4 T G 1: 34,846,405 (GRCm39) probably benign Het
Atg14 T C 14: 47,788,921 (GRCm39) N144S probably benign Het
Cacna1h A T 17: 25,602,160 (GRCm39) M1454K probably damaging Het
Catsperb A T 12: 101,412,327 (GRCm39) H138L possibly damaging Het
Cd200r2 T A 16: 44,729,934 (GRCm39) D159E probably benign Het
Cd79a G T 7: 24,598,687 (GRCm39) G79C probably damaging Het
Ceacam20 A G 7: 19,712,133 (GRCm39) H38R possibly damaging Het
Cers1 T C 8: 70,770,947 (GRCm39) L119P probably damaging Het
Ces1f C A 8: 93,992,423 (GRCm39) V343L probably benign Het
Ces3a G A 8: 105,784,550 (GRCm39) G511S possibly damaging Het
Cyfip2 A G 11: 46,175,079 (GRCm39) C98R probably benign Het
Cyp2j11 C A 4: 96,228,113 (GRCm39) V169L probably benign Het
Cyp4f17 A G 17: 32,747,860 (GRCm39) T523A probably benign Het
Ddx31 T C 2: 28,776,981 (GRCm39) S567P probably damaging Het
Dnase1l1 C T X: 73,320,644 (GRCm39) probably null Het
Dsg1b A C 18: 20,542,121 (GRCm39) H876P probably damaging Het
Edrf1 G T 7: 133,260,339 (GRCm39) M83I probably damaging Het
Eno4 T C 19: 58,948,679 (GRCm39) F393S possibly damaging Het
Eral1 C T 11: 77,969,183 (GRCm39) D106N probably benign Het
Esp18 G T 17: 39,719,070 (GRCm39) R23M probably benign Het
Fam184b C T 5: 45,697,143 (GRCm39) V674I probably benign Het
Fbxw13 A C 9: 109,013,225 (GRCm39) N154K probably benign Het
Gtpbp6 A G 5: 110,254,991 (GRCm39) V130A probably damaging Het
Hc T C 2: 34,903,050 (GRCm39) D1067G possibly damaging Het
Ighg1 A T 12: 113,294,126 (GRCm39) S6T unknown Het
Ikzf3 C T 11: 98,357,912 (GRCm39) R475H probably damaging Het
Itprid1 T A 6: 55,945,796 (GRCm39) probably null Het
Kcmf1 A T 6: 72,819,913 (GRCm39) L311* probably null Het
Kmt2d C A 15: 98,752,967 (GRCm39) E184D probably damaging Het
Maml2 A C 9: 13,617,763 (GRCm39) S370R probably damaging Het
Mroh1 C A 15: 76,316,547 (GRCm39) probably benign Het
Mx1 A T 16: 97,255,347 (GRCm39) Y235* probably null Het
Or4x6 A G 2: 89,949,013 (GRCm39) *310Q probably null Het
Pamr1 T G 2: 102,469,662 (GRCm39) Y403D probably damaging Het
Panx2 A G 15: 88,953,162 (GRCm39) E551G possibly damaging Het
Patl2 A G 2: 121,955,762 (GRCm39) V258A probably benign Het
Ppm1m A G 9: 106,074,041 (GRCm39) F255L probably benign Het
Prpf40a G T 2: 53,046,938 (GRCm39) T266N possibly damaging Het
Psg18 T A 7: 18,087,350 (GRCm39) I103F probably benign Het
Rpl39-ps A G 15: 102,543,583 (GRCm39) noncoding transcript Het
Rps6kb1 A T 11: 86,423,663 (GRCm39) F106I probably damaging Het
Rsf1 CG CGACGGCGGTG 7: 97,229,115 (GRCm39) probably benign Het
Sardh G T 2: 27,129,710 (GRCm39) T245K possibly damaging Het
Shprh T G 10: 11,088,074 (GRCm39) I1619S possibly damaging Het
Skint1 G A 4: 111,882,729 (GRCm39) V258I probably benign Het
Slc27a5 T C 7: 12,728,869 (GRCm39) D331G probably benign Het
Slc29a2 A G 19: 5,079,303 (GRCm39) I309V probably benign Het
Slc30a5 C T 13: 100,957,680 (GRCm39) V130I possibly damaging Het
Slc4a3 C A 1: 75,529,300 (GRCm39) A531D probably damaging Het
Slc6a16 C T 7: 44,910,672 (GRCm39) T399I probably benign Het
Slitrk6 T A 14: 110,987,529 (GRCm39) H726L probably benign Het
Snx2 A G 18: 53,343,784 (GRCm39) K309R probably damaging Het
Speer4f2 T A 5: 17,578,217 (GRCm39) C4S possibly damaging Het
Sulf1 T C 1: 12,867,131 (GRCm39) V105A probably benign Het
Tcstv7a A T 13: 120,289,899 (GRCm39) V99E probably damaging Het
Tmem8b G A 4: 43,673,992 (GRCm39) V208I probably benign Het
Vmn1r47 T C 6: 89,999,195 (GRCm39) L109P probably damaging Het
Vmn1r73 C A 7: 11,490,376 (GRCm39) Q65K possibly damaging Het
Vmn1r76 T C 7: 11,664,611 (GRCm39) Y166C probably damaging Het
Vmn2r2 T C 3: 64,034,011 (GRCm39) T504A probably benign Het
Wdr75 C A 1: 45,851,324 (GRCm39) A300E probably benign Het
Yars1 A G 4: 129,091,039 (GRCm39) E149G possibly damaging Het
Zbtb18 T C 1: 177,274,771 (GRCm39) F35L probably damaging Het
Zfp366 A G 13: 99,366,093 (GRCm39) Y418C probably damaging Het
Other mutations in Lrguk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:Lrguk APN 6 34,020,364 (GRCm39) missense probably damaging 1.00
IGL00566:Lrguk APN 6 34,033,109 (GRCm39) missense probably damaging 1.00
IGL01720:Lrguk APN 6 34,020,412 (GRCm39) missense probably damaging 1.00
IGL02325:Lrguk APN 6 34,106,114 (GRCm39) missense probably benign 0.31
IGL02484:Lrguk APN 6 34,069,726 (GRCm39) missense probably damaging 1.00
IGL02493:Lrguk APN 6 34,106,127 (GRCm39) missense probably benign 0.03
IGL02636:Lrguk APN 6 34,067,123 (GRCm39) missense probably damaging 1.00
IGL03278:Lrguk APN 6 34,093,381 (GRCm39) missense possibly damaging 0.80
R0031:Lrguk UTSW 6 34,020,431 (GRCm39) missense probably damaging 0.99
R1069:Lrguk UTSW 6 34,025,818 (GRCm39) missense possibly damaging 0.63
R1487:Lrguk UTSW 6 34,039,295 (GRCm39) missense probably benign 0.01
R1568:Lrguk UTSW 6 34,063,373 (GRCm39) missense probably damaging 1.00
R1604:Lrguk UTSW 6 34,049,305 (GRCm39) missense possibly damaging 0.67
R1847:Lrguk UTSW 6 34,110,322 (GRCm39) missense possibly damaging 0.52
R2045:Lrguk UTSW 6 34,048,003 (GRCm39) missense probably damaging 1.00
R2107:Lrguk UTSW 6 34,039,296 (GRCm39) missense probably benign 0.15
R2125:Lrguk UTSW 6 34,069,837 (GRCm39) missense probably benign 0.05
R2136:Lrguk UTSW 6 34,020,454 (GRCm39) missense probably benign 0.00
R2997:Lrguk UTSW 6 34,050,697 (GRCm39) missense probably damaging 0.98
R3847:Lrguk UTSW 6 34,050,703 (GRCm39) missense probably damaging 1.00
R3849:Lrguk UTSW 6 34,050,703 (GRCm39) missense probably damaging 1.00
R4626:Lrguk UTSW 6 34,106,158 (GRCm39) missense probably benign 0.00
R4718:Lrguk UTSW 6 34,006,431 (GRCm39) missense probably benign 0.02
R4778:Lrguk UTSW 6 34,033,015 (GRCm39) missense probably damaging 1.00
R4841:Lrguk UTSW 6 34,069,802 (GRCm39) missense probably damaging 0.98
R5324:Lrguk UTSW 6 34,050,732 (GRCm39) missense possibly damaging 0.87
R5741:Lrguk UTSW 6 34,025,802 (GRCm39) missense probably damaging 0.99
R5939:Lrguk UTSW 6 34,055,688 (GRCm39) missense probably damaging 1.00
R5997:Lrguk UTSW 6 34,106,078 (GRCm39) missense probably damaging 0.99
R6786:Lrguk UTSW 6 34,072,522 (GRCm39) missense probably benign 0.11
R6802:Lrguk UTSW 6 34,039,392 (GRCm39) missense probably damaging 1.00
R7081:Lrguk UTSW 6 34,079,074 (GRCm39) missense probably benign 0.01
R7303:Lrguk UTSW 6 34,006,411 (GRCm39) missense probably benign 0.00
R7316:Lrguk UTSW 6 34,080,191 (GRCm39) missense unknown
R7473:Lrguk UTSW 6 34,006,630 (GRCm39) missense probably benign 0.01
R7543:Lrguk UTSW 6 34,025,870 (GRCm39) nonsense probably null
R7613:Lrguk UTSW 6 34,078,683 (GRCm39) missense possibly damaging 0.68
R7716:Lrguk UTSW 6 34,072,474 (GRCm39) missense probably damaging 1.00
R7900:Lrguk UTSW 6 34,106,129 (GRCm39) missense probably benign 0.01
R8012:Lrguk UTSW 6 34,033,038 (GRCm39) missense probably benign 0.00
R8251:Lrguk UTSW 6 34,093,374 (GRCm39) missense probably benign 0.00
R8324:Lrguk UTSW 6 34,079,506 (GRCm39) missense probably benign 0.03
R8551:Lrguk UTSW 6 34,093,446 (GRCm39) missense probably damaging 0.96
R8828:Lrguk UTSW 6 34,080,572 (GRCm39) missense unknown
R8879:Lrguk UTSW 6 34,006,618 (GRCm39) missense probably benign 0.00
X0057:Lrguk UTSW 6 34,055,682 (GRCm39) missense probably benign 0.40
Predicted Primers PCR Primer
(F):5'- CCGAAGTTAATGTGCTCTTTCCTG -3'
(R):5'- GGGCTGTATTCACCTTCCTG -3'

Sequencing Primer
(F):5'- GCCTTGTGGTATTCTCATTGAAAAGC -3'
(R):5'- CTGATGCTCCCAATCAATGC -3'
Posted On 2017-06-23