Incidental Mutation 'R5368:Qk'
ID478326
Institutional Source Beutler Lab
Gene Symbol Qk
Ensembl Gene ENSMUSG00000062078
Gene Namequaking
SynonymsQkI, l(17)-1Wis, l17Wis1, 1110003F05Rik
MMRRC Submission 043204-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5368 (G1)
Quality Score166
Status Validated
Chromosome17
Chromosomal Location10206471-10319361 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 10239035 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Alanine at position 135 (E135A)
Ref Sequence ENSEMBL: ENSMUSP00000095025 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042296] [ENSMUST00000097414]
Predicted Effect probably damaging
Transcript: ENSMUST00000042296
AA Change: E135A

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000046740
Gene: ENSMUSG00000062078
AA Change: E135A

DomainStartEndE-ValueType
KH 80 174 4.74e-9 SMART
low complexity region 211 226 N/A INTRINSIC
low complexity region 230 250 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000097414
AA Change: E135A

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000095025
Gene: ENSMUSG00000062078
AA Change: E135A

DomainStartEndE-ValueType
Pfam:STAR_dimer 10 68 9.4e-31 PFAM
KH 80 174 4.74e-9 SMART
low complexity region 211 226 N/A INTRINSIC
low complexity region 230 250 N/A INTRINSIC
Pfam:Quaking_NLS 312 341 5.5e-24 PFAM
Meta Mutation Damage Score 0.2485 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 97% (61/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an RNA-binding protein that regulates pre-mRNA splicing, export of mRNAs from the nucleus, protein translation, and mRNA stability. The encoded protein is involved in myelinization and oligodendrocyte differentiation and may play a role in schizophrenia. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2014]
PHENOTYPE: Knock-out mice die in utero with defects in embryo turning, blood vessel, smooth muscle, cardiac and neural tube development. Homozygotes for a spontaneous allele are viable but show myelin, spermatogenic and behavioral defects, hind leg tremors and seizures. Most ENU-induced mutants die in utero. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933402N03Rik T A 7: 131,139,196 H97L possibly damaging Het
Abca9 T A 11: 110,145,546 N579I probably damaging Het
Acbd3 A T 1: 180,722,095 probably benign Het
Ankrd50 A T 3: 38,455,050 I1056N probably damaging Het
Ceacam18 T C 7: 43,642,034 V300A probably benign Het
Cfap46 C A 7: 139,627,473 R1843S possibly damaging Het
D430041D05Rik A G 2: 104,248,284 V1229A probably damaging Het
Dbx2 G A 15: 95,640,641 S206L probably benign Het
Dnah11 A T 12: 117,954,893 D1530E probably damaging Het
Ecm2 A C 13: 49,520,943 T280P probably benign Het
Emc2 G A 15: 43,511,811 probably null Het
Epb42 C T 2: 121,019,462 V689I probably benign Het
Fam114a1 T A 5: 65,006,109 M209K possibly damaging Het
Fam117a C T 11: 95,375,633 S193F probably damaging Het
Foxp2 A T 6: 15,377,914 probably benign Het
Frmd6 T A 12: 70,864,100 C19* probably null Het
Fyb A G 15: 6,580,678 probably null Het
Gata6 C A 18: 11,063,059 H442Q possibly damaging Het
Gldc A G 19: 30,158,521 S160P probably benign Het
Gm3952 A G 8: 128,745,974 S1626P possibly damaging Het
Gm9762 T A 3: 78,966,435 noncoding transcript Het
Gtpbp2 T C 17: 46,166,304 probably benign Het
Hgd A T 16: 37,589,751 T50S probably benign Het
Itpr1 C T 6: 108,387,498 T22M probably damaging Het
Kif26b G A 1: 178,915,884 E1182K probably damaging Het
Kirrel3 A G 9: 35,007,738 E230G probably damaging Het
Leng8 A G 7: 4,139,988 Y88C probably damaging Het
Lpo T C 11: 87,821,069 D54G possibly damaging Het
Lypd2 G T 15: 74,733,059 A29E probably benign Het
Mdn1 C T 4: 32,723,690 P2542L probably damaging Het
Mical3 T C 6: 120,959,473 Y1364C probably damaging Het
Mroh2b A G 15: 4,905,572 N163S probably damaging Het
Mtf1 G A 4: 124,825,079 C295Y probably damaging Het
Nbn T A 4: 15,969,391 L212Q probably damaging Het
Obscn A T 11: 59,069,026 probably null Het
Olfr1118 T A 2: 87,308,782 probably null Het
Olfr1215 A G 2: 89,002,091 S66P probably damaging Het
Peli1 A G 11: 21,148,389 T375A probably damaging Het
Picalm T C 7: 90,207,595 *611Q probably null Het
Plch1 G T 3: 63,701,973 Q938K possibly damaging Het
Plxnb2 A G 15: 89,159,593 V1352A possibly damaging Het
Pmepa1 G A 2: 173,228,322 R147W probably damaging Het
Prdm16 T G 4: 154,345,391 K373Q probably damaging Het
Rad50 T C 11: 53,684,246 K556E probably benign Het
Scara5 CG C 14: 65,759,662 probably null Het
Sin3a T A 9: 57,110,800 D834E possibly damaging Het
Smg8 G A 11: 87,080,260 S895L probably benign Het
Sorl1 T C 9: 41,979,390 I1944M probably benign Het
Stam2 G A 2: 52,736,293 probably benign Het
Tmprss7 A T 16: 45,660,889 W645R probably damaging Het
Tns1 T C 1: 73,941,017 M1111V probably benign Het
Ttn A C 2: 76,778,382 D17763E probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ubr4 G A 4: 139,397,528 probably benign Het
Usp31 T C 7: 121,661,365 H637R probably damaging Het
Vps50 A C 6: 3,567,739 E545A possibly damaging Het
Wdfy3 G T 5: 101,872,858 L2527M probably damaging Het
Wfdc2 T C 2: 164,563,434 V85A possibly damaging Het
Other mutations in Qk
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0165:Qk UTSW 17 10238963 missense probably damaging 1.00
R0268:Qk UTSW 17 10209646 splice site probably benign
R3963:Qk UTSW 17 10216465 splice site probably benign
R4732:Qk UTSW 17 10216288 missense probably damaging 0.98
R4733:Qk UTSW 17 10216288 missense probably damaging 0.98
R5153:Qk UTSW 17 10238891 critical splice donor site probably null
R5161:Qk UTSW 17 10215490 intron probably null
R5833:Qk UTSW 17 10216387 missense probably damaging 1.00
R6466:Qk UTSW 17 10215465 missense probably benign
R6880:Qk UTSW 17 10215447 missense probably benign 0.00
R8068:Qk UTSW 17 10318803 missense possibly damaging 0.57
Predicted Primers PCR Primer
(F):5'- GGCTAGTTAGGCTTGTTTCTCTACC -3'
(R):5'- GTCCCATTGCAAGGCTTTTG -3'

Sequencing Primer
(F):5'- AGCAGGGATTTTTGAGCAATCC -3'
(R):5'- GTCCCATTGCAAGGCTTTTGATTAC -3'
Posted On2017-06-23