Incidental Mutation 'R5402:Hus1'
ID478346
Institutional Source Beutler Lab
Gene Symbol Hus1
Ensembl Gene ENSMUSG00000020413
Gene NameHUS1 checkpoint clamp component
Synonyms
MMRRC Submission 042973-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5402 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location8993137-9011191 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to T at 9010240 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000020683 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020683] [ENSMUST00000020683] [ENSMUST00000129115]
Predicted Effect probably null
Transcript: ENSMUST00000020683
SMART Domains Protein: ENSMUSP00000020683
Gene: ENSMUSG00000020413

DomainStartEndE-ValueType
Pfam:Hus1 1 280 5.1e-86 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000020683
SMART Domains Protein: ENSMUSP00000020683
Gene: ENSMUSG00000020413

DomainStartEndE-ValueType
Pfam:Hus1 1 280 5.1e-86 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127578
Predicted Effect probably benign
Transcript: ENSMUST00000129115
SMART Domains Protein: ENSMUSP00000114339
Gene: ENSMUSG00000020413

DomainStartEndE-ValueType
Pfam:Hus1 1 280 4.8e-89 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139877
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146002
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152890
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a component of a cell cycle checkpoint complex that causes cell cycle arrest in response to bulky DNA lesions and DNA replication blockage. Together with the proteins Rad9 and Rad1, the encoded protein forms a heterotrimeric complex known as the 9-1-1 complex. Mice lacking the encoded protein develop spontaneous chromosomal abnormalities resulting in embryonic lethality. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jan 2015]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit defects in yolk sac vascularization, placental abnormalities, extensive apoptosis, and midgestational lethality. Mutant cells show increased chromosomal abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 A T 13: 81,459,715 D4079E probably benign Het
Bcar1 T C 8: 111,714,330 D344G probably damaging Het
Car9 A G 4: 43,510,213 N265S probably damaging Het
Ccr7 A G 11: 99,145,734 S121P possibly damaging Het
Cgnl1 A G 9: 71,629,321 L1278P probably damaging Het
Chst9 A T 18: 15,452,815 S230R probably damaging Het
Cped1 G A 6: 22,143,952 V566M probably benign Het
Csf2 A T 11: 54,247,663 Y117* probably null Het
Cwf19l1 C T 19: 44,133,085 probably null Het
Cyp2d34 C T 15: 82,619,086 G69D probably damaging Het
Dync2h1 A T 9: 7,114,949 V170E probably damaging Het
Ehbp1l1 T A 19: 5,716,320 T388S possibly damaging Het
Etfa T C 9: 55,454,739 I329M probably benign Het
Flt4 AC ACC 11: 49,651,034 probably null Het
Fmnl2 G A 2: 53,128,782 V1078I probably damaging Het
Fnip2 A G 3: 79,480,943 L797P possibly damaging Het
Gm10130 A G 2: 150,362,966 I67V probably benign Het
Gm13103 G A 4: 143,851,655 probably null Het
Gmeb2 A T 2: 181,255,957 probably null Het
Greb1l A G 18: 10,537,169 T1045A probably benign Het
Hapln1 A G 13: 89,605,411 N232S probably benign Het
Hibadh A T 6: 52,546,980 M311K probably benign Het
Il31ra T C 13: 112,524,135 E640G probably benign Het
L3mbtl4 T C 17: 68,455,774 F101L probably damaging Het
Lbr A T 1: 181,819,961 M417K probably benign Het
Lrig3 T G 10: 126,008,740 L691R probably damaging Het
Mcm3ap T A 10: 76,483,314 F792Y probably benign Het
Mst1 T C 9: 108,084,209 probably null Het
Nova2 C A 7: 18,958,446 T500K probably damaging Het
Nxph4 A T 10: 127,526,264 C253S probably damaging Het
Olfr1193 T A 2: 88,678,148 S98T possibly damaging Het
Olfr31 T C 14: 14,328,878 Y256H probably damaging Het
Pcdhga3 G A 18: 37,675,694 R400Q probably benign Het
Pidd1 C A 7: 141,438,594 A915S probably damaging Het
Plat T G 8: 22,772,722 W148G probably damaging Het
Polr3a T C 14: 24,454,941 I1084V possibly damaging Het
Ptdss1 A G 13: 66,933,599 D31G possibly damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Samd8 A G 14: 21,775,168 D64G probably damaging Het
Scgb1b20 A G 7: 33,373,231 probably null Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Slc25a23 T C 17: 57,053,336 I269V probably benign Het
Slc35f4 A T 14: 49,318,874 S141T probably damaging Het
Srgap1 T C 10: 121,785,760 M966V probably benign Het
Syne2 T A 12: 76,059,439 V5526E probably damaging Het
Tcaf3 A G 6: 42,591,926 S596P probably benign Het
Tg T A 15: 66,739,168 I356N probably damaging Het
Ttc6 C T 12: 57,737,031 R1759* probably null Het
Wdsub1 T C 2: 59,870,478 N138D probably benign Het
Other mutations in Hus1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01543:Hus1 APN 11 9000082 missense probably benign 0.00
IGL01974:Hus1 APN 11 9000088 missense possibly damaging 0.58
IGL02301:Hus1 APN 11 8996915 missense probably benign
IGL02436:Hus1 APN 11 9006057 missense possibly damaging 0.93
R0694:Hus1 UTSW 11 9007531 nonsense probably null
R2108:Hus1 UTSW 11 9011110 start codon destroyed probably null 1.00
R2128:Hus1 UTSW 11 9006011 missense probably damaging 1.00
R2329:Hus1 UTSW 11 9007492 critical splice donor site probably null
R4363:Hus1 UTSW 11 8998676 missense probably damaging 1.00
R4420:Hus1 UTSW 11 9000133 missense probably damaging 1.00
R4453:Hus1 UTSW 11 9006035 missense probably damaging 1.00
R4572:Hus1 UTSW 11 9007617 splice site probably null
R4818:Hus1 UTSW 11 8996808 utr 3 prime probably benign
R4913:Hus1 UTSW 11 8996856 missense probably benign 0.03
R4989:Hus1 UTSW 11 9006027 missense probably damaging 0.97
R5902:Hus1 UTSW 11 9010669 intron probably benign
R6402:Hus1 UTSW 11 9010407 missense probably damaging 1.00
R7792:Hus1 UTSW 11 9000133 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGTGCCATCATGACTGTTTAC -3'
(R):5'- AAGGCCACAAATGCCTGTTTC -3'

Sequencing Primer
(F):5'- TTTGAGACAGAGTCCTGGAACTCAC -3'
(R):5'- ACAAATGCCTGTTTCTGTTCTGCAG -3'
Posted On2017-06-23