Incidental Mutation 'Z31818:Ugt1a6b'
ID478390
Institutional Source Beutler Lab
Gene Symbol Ugt1a6b
Ensembl Gene ENSMUSG00000090145
Gene NameUDP glucuronosyltransferase 1 family, polypeptide A6B
SynonymsA9'
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.134) question?
Stock #Z31818 (F1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location88103252-88219003 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 88107155 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 72 (Y72H)
Ref Sequence ENSEMBL: ENSMUSP00000108763 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058237] [ENSMUST00000073772] [ENSMUST00000113135] [ENSMUST00000113137] [ENSMUST00000113138] [ENSMUST00000113139] [ENSMUST00000113142] [ENSMUST00000126203] [ENSMUST00000138182] [ENSMUST00000150634] [ENSMUST00000173325]
Predicted Effect probably benign
Transcript: ENSMUST00000058237
SMART Domains Protein: ENSMUSP00000058683
Gene: ENSMUSG00000090124

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:UDPGT 26 522 1.5e-234 PFAM
Pfam:Glyco_tran_28_C 361 450 4.5e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000073772
SMART Domains Protein: ENSMUSP00000073444
Gene: ENSMUSG00000090175

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:UDPGT 24 519 2.3e-232 PFAM
Pfam:Glyco_tran_28_C 358 447 4.5e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113135
SMART Domains Protein: ENSMUSP00000108760
Gene: ENSMUSG00000090124

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:UDPGT 27 522 1.2e-229 PFAM
Pfam:Glyco_tran_28_C 363 448 1e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113137
AA Change: Y72H

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000108762
Gene: ENSMUSG00000090145
AA Change: Y72H

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:UDPGT 27 522 1.3e-231 PFAM
Pfam:Glyco_tran_28_C 361 450 2.8e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113138
AA Change: Y72H

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000108763
Gene: ENSMUSG00000090145
AA Change: Y72H

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:UDPGT 27 522 7.3e-229 PFAM
Pfam:Glyco_tran_28_C 363 448 6.6e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113139
SMART Domains Protein: ENSMUSP00000108764
Gene: ENSMUSG00000089675

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:UDPGT 26 521 3.6e-237 PFAM
Pfam:Glyco_tran_28_C 360 449 1.3e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113142
SMART Domains Protein: ENSMUSP00000108767
Gene: ENSMUSG00000090165

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:UDPGT 26 521 7.3e-231 PFAM
Pfam:Glyco_tran_28_C 360 449 1.3e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126203
SMART Domains Protein: ENSMUSP00000116653
Gene: ENSMUSG00000090124

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:UDPGT 26 62 4.6e-11 PFAM
Pfam:UDPGT 59 127 8.9e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138182
SMART Domains Protein: ENSMUSP00000119985
Gene: ENSMUSG00000090165

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:UDPGT 26 62 7e-11 PFAM
Pfam:UDPGT 58 207 1.9e-90 PFAM
Pfam:Glyco_tran_28_C 137 207 4.8e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000150634
SMART Domains Protein: ENSMUSP00000123452
Gene: ENSMUSG00000090124

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:UDPGT 26 62 9.5e-11 PFAM
Pfam:UDPGT 58 207 2e-90 PFAM
Pfam:Glyco_tran_28_C 137 207 4.8e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173165
Predicted Effect probably benign
Transcript: ENSMUST00000173325
SMART Domains Protein: ENSMUSP00000134443
Gene: ENSMUSG00000090165

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:UDPGT 26 61 3.4e-10 PFAM
Pfam:UDPGT 59 210 8.9e-92 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 96.9%
  • 20x: 89.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 14 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Dmrtc2 C A 7: 24,877,158 P336T probably benign Het
Flt3 C T 5: 147,366,918 probably null Het
Fndc5 G A 4: 129,139,349 D70N probably damaging Het
Gan T A 8: 117,195,797 I423N probably damaging Het
Itpr3 T G 17: 27,095,478 L634R probably damaging Het
Ndufb5 T A 3: 32,746,461 M74K probably benign Het
Olfr1160 A T 2: 88,005,890 L287* probably null Het
Osbpl6 A G 2: 76,555,082 R287G probably damaging Het
Pkd1l3 A C 8: 109,669,292 N2098T probably damaging Het
Proser3 G A 7: 30,546,365 P97L possibly damaging Het
Rag2 G A 2: 101,630,805 A487T probably damaging Het
Sorl1 A T 9: 42,041,596 C716* probably null Het
Vmn2r74 T C 7: 85,955,521 probably null Het
Vps13a C T 19: 16,780,754 V6M possibly damaging Het
Other mutations in Ugt1a6b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00980:Ugt1a6b APN 1 88107605 missense possibly damaging 0.93
IGL00990:Ugt1a6b APN 1 88215178 splice site probably null
IGL02139:Ugt1a6b APN 1 88107805 intron probably benign
PIT4131001:Ugt1a6b UTSW 1 88216158 small deletion probably benign
PIT4131001:Ugt1a6b UTSW 1 88216254 missense probably damaging 1.00
PIT4131001:Ugt1a6b UTSW 1 88218390 missense probably damaging 1.00
R0164:Ugt1a6b UTSW 1 88107467 missense probably damaging 0.99
R0966:Ugt1a6b UTSW 1 88107128 missense probably benign 0.04
R1368:Ugt1a6b UTSW 1 88107636 missense probably benign 0.08
R1542:Ugt1a6b UTSW 1 88107261 missense probably benign 0.04
R3693:Ugt1a6b UTSW 1 88107794 missense probably benign
R4528:Ugt1a6b UTSW 1 88107579 missense probably damaging 0.99
R5206:Ugt1a6b UTSW 1 88107448 nonsense probably null
R5272:Ugt1a6b UTSW 1 88107227 missense possibly damaging 0.73
R5977:Ugt1a6b UTSW 1 88216260 missense probably damaging 1.00
R6640:Ugt1a6b UTSW 1 88107794 missense probably benign
R6723:Ugt1a6b UTSW 1 88107717 missense probably benign 0.15
Predicted Primers PCR Primer
(F):5'- GACACTTCCTGCAGGGTTTC -3'
(R):5'- TTGTTCTCCCTGAGGAAGCTG -3'

Sequencing Primer
(F):5'- GCAGGGTTTCTCTTCCTAGTGC -3'
(R):5'- TGGCAGAGTCCTTCAGGAG -3'
Posted On2017-06-26