Incidental Mutation 'Z31818:Olfr1160'
ID478392
Institutional Source Beutler Lab
Gene Symbol Olfr1160
Ensembl Gene ENSMUSG00000075141
Gene Nameolfactory receptor 1160
SynonymsMOR173-1, GA_x6K02T2Q125-49498697-49497765
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock #Z31818 (F1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location88000927-88008268 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 88005890 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 287 (L287*)
Ref Sequence ENSEMBL: ENSMUSP00000148857 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099839] [ENSMUST00000215457]
Predicted Effect probably null
Transcript: ENSMUST00000099839
AA Change: L296*
SMART Domains Protein: ENSMUSP00000097427
Gene: ENSMUSG00000075141
AA Change: L296*

DomainStartEndE-ValueType
Pfam:7tm_4 40 316 1.2e-46 PFAM
Pfam:7tm_1 50 298 2e-17 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000215457
AA Change: L287*
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 96.9%
  • 20x: 89.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 14 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Dmrtc2 C A 7: 24,877,158 P336T probably benign Het
Flt3 C T 5: 147,366,918 probably null Het
Fndc5 G A 4: 129,139,349 D70N probably damaging Het
Gan T A 8: 117,195,797 I423N probably damaging Het
Itpr3 T G 17: 27,095,478 L634R probably damaging Het
Ndufb5 T A 3: 32,746,461 M74K probably benign Het
Osbpl6 A G 2: 76,555,082 R287G probably damaging Het
Pkd1l3 A C 8: 109,669,292 N2098T probably damaging Het
Proser3 G A 7: 30,546,365 P97L possibly damaging Het
Rag2 G A 2: 101,630,805 A487T probably damaging Het
Sorl1 A T 9: 42,041,596 C716* probably null Het
Ugt1a6b T C 1: 88,107,155 Y72H probably benign Het
Vmn2r74 T C 7: 85,955,521 probably null Het
Vps13a C T 19: 16,780,754 V6M possibly damaging Het
Other mutations in Olfr1160
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Olfr1160 APN 2 88006644 missense probably damaging 1.00
IGL01321:Olfr1160 APN 2 88006245 missense probably damaging 0.97
IGL02009:Olfr1160 APN 2 88006773 missense probably benign
IGL03409:Olfr1160 APN 2 88005895 missense probably damaging 1.00
R0089:Olfr1160 UTSW 2 88005987 missense probably damaging 1.00
R0685:Olfr1160 UTSW 2 88006418 missense probably damaging 1.00
R1416:Olfr1160 UTSW 2 88006571 missense probably damaging 1.00
R1852:Olfr1160 UTSW 2 88006521 missense probably damaging 1.00
R1965:Olfr1160 UTSW 2 88006304 missense probably damaging 1.00
R2206:Olfr1160 UTSW 2 88006235 missense probably benign 0.00
R4853:Olfr1160 UTSW 2 88006104 missense probably damaging 1.00
R5599:Olfr1160 UTSW 2 88006005 missense probably benign 0.44
R6851:Olfr1160 UTSW 2 88005956 missense probably damaging 0.98
R6995:Olfr1160 UTSW 2 88006185 missense probably benign 0.00
R7817:Olfr1160 UTSW 2 88006011 missense probably benign
Z1176:Olfr1160 UTSW 2 88006437 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CTGCAATTTCTTTCATGATGGATCC -3'
(R):5'- GTGGCCATTTGTAAAATAGGTTCTG -3'

Sequencing Primer
(F):5'- GATCCTCATTATACATACAATTGGGG -3'
(R):5'- TTGTAAAATAGGTTCTGCAGAAGG -3'
Posted On2017-06-26