Incidental Mutation 'Z31818:Ndufb5'
ID478394
Institutional Source Beutler Lab
Gene Symbol Ndufb5
Ensembl Gene ENSMUSG00000027673
Gene NameNADH dehydrogenase (ubiquinone) 1 beta subcomplex, 5
Synonyms0610007D05Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.825) question?
Stock #Z31818 (F1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location32736990-32751566 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 32746461 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 74 (M74K)
Ref Sequence ENSEMBL: ENSMUSP00000115088 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029217] [ENSMUST00000121778] [ENSMUST00000122290] [ENSMUST00000127477] [ENSMUST00000139593] [ENSMUST00000154257]
Predicted Effect probably benign
Transcript: ENSMUST00000029217
Predicted Effect probably benign
Transcript: ENSMUST00000121778
AA Change: M76K

PolyPhen 2 Score 0.187 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000113169
Gene: ENSMUSG00000027673
AA Change: M76K

DomainStartEndE-ValueType
Pfam:NDUF_B5 1 163 5.1e-75 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000122290
AA Change: M6K

PolyPhen 2 Score 0.065 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000113602
Gene: ENSMUSG00000027673
AA Change: M6K

DomainStartEndE-ValueType
Pfam:NDUF_B5 1 119 1.1e-68 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127477
AA Change: M76K

PolyPhen 2 Score 0.112 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000114963
Gene: ENSMUSG00000027673
AA Change: M76K

DomainStartEndE-ValueType
Pfam:NDUF_B5 1 189 3.5e-91 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139593
AA Change: M74K

PolyPhen 2 Score 0.187 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000115088
Gene: ENSMUSG00000027673
AA Change: M74K

DomainStartEndE-ValueType
Pfam:NDUF_B5 6 172 6e-79 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154257
AA Change: M61K

PolyPhen 2 Score 0.112 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000117240
Gene: ENSMUSG00000027673
AA Change: M61K

DomainStartEndE-ValueType
Pfam:NDUF_B5 1 135 8.4e-69 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156174
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 96.9%
  • 20x: 89.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a subunit of the multisubunit NADH:ubiquinone oxidoreductase (complex I). Mammalian complex I is composed of 45 different subunits. It locates at the mitochondrial inner membrane. This protein has NADH dehydrogenase activity and oxidoreductase activity. It transfers electrons from NADH to the respiratory chain. The immediate electron acceptor for the enzyme is believed to be ubiquinone. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2011]
Allele List at MGI
Other mutations in this stock
Total: 14 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Dmrtc2 C A 7: 24,877,158 P336T probably benign Het
Flt3 C T 5: 147,366,918 probably null Het
Fndc5 G A 4: 129,139,349 D70N probably damaging Het
Gan T A 8: 117,195,797 I423N probably damaging Het
Itpr3 T G 17: 27,095,478 L634R probably damaging Het
Olfr1160 A T 2: 88,005,890 L287* probably null Het
Osbpl6 A G 2: 76,555,082 R287G probably damaging Het
Pkd1l3 A C 8: 109,669,292 N2098T probably damaging Het
Proser3 G A 7: 30,546,365 P97L possibly damaging Het
Rag2 G A 2: 101,630,805 A487T probably damaging Het
Sorl1 A T 9: 42,041,596 C716* probably null Het
Ugt1a6b T C 1: 88,107,155 Y72H probably benign Het
Vmn2r74 T C 7: 85,955,521 probably null Het
Vps13a C T 19: 16,780,754 V6M possibly damaging Het
Other mutations in Ndufb5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00502:Ndufb5 APN 3 32744899 missense probably damaging 0.98
IGL01688:Ndufb5 APN 3 32746464 nonsense probably null
IGL02629:Ndufb5 APN 3 32737199 missense probably benign 0.02
R0084:Ndufb5 UTSW 3 32737203 missense probably benign 0.02
R2851:Ndufb5 UTSW 3 32746451 missense probably damaging 1.00
R5663:Ndufb5 UTSW 3 32747749 missense possibly damaging 0.90
R5742:Ndufb5 UTSW 3 32747781 missense probably damaging 0.99
R6609:Ndufb5 UTSW 3 32741683 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGGCTGAAATGCTACTGTTTTC -3'
(R):5'- AGTGTGTGGTCGCAGCAATG -3'

Sequencing Primer
(F):5'- TCTCATTGCTTTAACCAAGAAGTC -3'
(R):5'- TGGTCGCAGCAATGCAAAAG -3'
Posted On2017-06-26