Incidental Mutation 'Z31818:Dmrtc2'
ID478397
Institutional Source Beutler Lab
Gene Symbol Dmrtc2
Ensembl Gene ENSMUSG00000011349
Gene Namedoublesex and mab-3 related transcription factor like family C2
SynonymsDmrt7, 4933432E21Rik
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.661) question?
Stock #Z31818 (F1)
Quality Score224.009
Status Not validated
Chromosome7
Chromosomal Location24870057-24877651 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 24877158 bp
ZygosityHeterozygous
Amino Acid Change Proline to Threonine at position 336 (P336T)
Ref Sequence ENSEMBL: ENSMUSP00000011493 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000011493]
Predicted Effect probably benign
Transcript: ENSMUST00000011493
AA Change: P336T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000011493
Gene: ENSMUSG00000011349
AA Change: P336T

DomainStartEndE-ValueType
DM 38 91 6.53e-21 SMART
low complexity region 163 189 N/A INTRINSIC
Pfam:DMRT-like 242 369 3.1e-54 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 96.9%
  • 20x: 89.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Males homozygous for a targeted allele are sterile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 14 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Flt3 C T 5: 147,366,918 probably null Het
Fndc5 G A 4: 129,139,349 D70N probably damaging Het
Gan T A 8: 117,195,797 I423N probably damaging Het
Itpr3 T G 17: 27,095,478 L634R probably damaging Het
Ndufb5 T A 3: 32,746,461 M74K probably benign Het
Olfr1160 A T 2: 88,005,890 L287* probably null Het
Osbpl6 A G 2: 76,555,082 R287G probably damaging Het
Pkd1l3 A C 8: 109,669,292 N2098T probably damaging Het
Proser3 G A 7: 30,546,365 P97L possibly damaging Het
Rag2 G A 2: 101,630,805 A487T probably damaging Het
Sorl1 A T 9: 42,041,596 C716* probably null Het
Ugt1a6b T C 1: 88,107,155 Y72H probably benign Het
Vmn2r74 T C 7: 85,955,521 probably null Het
Vps13a C T 19: 16,780,754 V6M possibly damaging Het
Other mutations in Dmrtc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01114:Dmrtc2 APN 7 24872576 missense probably damaging 1.00
IGL02122:Dmrtc2 APN 7 24872583 missense possibly damaging 0.71
IGL02469:Dmrtc2 APN 7 24872713 unclassified probably benign
R1173:Dmrtc2 UTSW 7 24874313 missense possibly damaging 0.94
R1775:Dmrtc2 UTSW 7 24874367 missense possibly damaging 0.57
R2167:Dmrtc2 UTSW 7 24873919 unclassified probably benign
R2924:Dmrtc2 UTSW 7 24872516 missense probably damaging 0.98
R3685:Dmrtc2 UTSW 7 24874262 missense probably benign
R4205:Dmrtc2 UTSW 7 24875806 nonsense probably null
R5455:Dmrtc2 UTSW 7 24872491 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TTATAGATGTGGCATGCGCG -3'
(R):5'- AATACCAAATATGCAGTGCCTG -3'

Sequencing Primer
(F):5'- ATCTGGGGAACGGTCTGAGC -3'
(R):5'- CAGTGCCTGCAGTTTGTCGTC -3'
Posted On2017-06-26