Incidental Mutation 'Z31818:Proser3'
ID478398
Institutional Source Beutler Lab
Gene Symbol Proser3
Ensembl Gene ENSMUSG00000036864
Gene Nameproline and serine rich 3
SynonymsBC053749
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #Z31818 (F1)
Quality Score222.009
Status Not validated
Chromosome7
Chromosomal Location30539134-30552299 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 30546365 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 97 (P97L)
Ref Sequence ENSEMBL: ENSMUSP00000148912 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062708] [ENSMUST00000108165] [ENSMUST00000153594] [ENSMUST00000215288]
Predicted Effect possibly damaging
Transcript: ENSMUST00000062708
AA Change: P97L

PolyPhen 2 Score 0.574 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000059135
Gene: ENSMUSG00000036864
AA Change: P97L

DomainStartEndE-ValueType
low complexity region 33 56 N/A INTRINSIC
low complexity region 128 140 N/A INTRINSIC
low complexity region 152 163 N/A INTRINSIC
low complexity region 179 202 N/A INTRINSIC
low complexity region 351 365 N/A INTRINSIC
low complexity region 369 383 N/A INTRINSIC
low complexity region 388 407 N/A INTRINSIC
low complexity region 599 614 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000108165
AA Change: P97L

PolyPhen 2 Score 0.574 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000103800
Gene: ENSMUSG00000036864
AA Change: P97L

DomainStartEndE-ValueType
low complexity region 33 56 N/A INTRINSIC
low complexity region 128 140 N/A INTRINSIC
low complexity region 152 163 N/A INTRINSIC
low complexity region 179 202 N/A INTRINSIC
low complexity region 351 365 N/A INTRINSIC
low complexity region 369 383 N/A INTRINSIC
low complexity region 388 407 N/A INTRINSIC
low complexity region 599 614 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134113
Predicted Effect probably benign
Transcript: ENSMUST00000153594
SMART Domains Protein: ENSMUSP00000123095
Gene: ENSMUSG00000036864

DomainStartEndE-ValueType
low complexity region 33 56 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208706
Predicted Effect possibly damaging
Transcript: ENSMUST00000215288
AA Change: P97L

PolyPhen 2 Score 0.851 (Sensitivity: 0.83; Specificity: 0.93)
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 96.9%
  • 20x: 89.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 14 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Dmrtc2 C A 7: 24,877,158 P336T probably benign Het
Flt3 C T 5: 147,366,918 probably null Het
Fndc5 G A 4: 129,139,349 D70N probably damaging Het
Gan T A 8: 117,195,797 I423N probably damaging Het
Itpr3 T G 17: 27,095,478 L634R probably damaging Het
Ndufb5 T A 3: 32,746,461 M74K probably benign Het
Olfr1160 A T 2: 88,005,890 L287* probably null Het
Osbpl6 A G 2: 76,555,082 R287G probably damaging Het
Pkd1l3 A C 8: 109,669,292 N2098T probably damaging Het
Rag2 G A 2: 101,630,805 A487T probably damaging Het
Sorl1 A T 9: 42,041,596 C716* probably null Het
Ugt1a6b T C 1: 88,107,155 Y72H probably benign Het
Vmn2r74 T C 7: 85,955,521 probably null Het
Vps13a C T 19: 16,780,754 V6M possibly damaging Het
Other mutations in Proser3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00533:Proser3 APN 7 30540671 missense possibly damaging 0.62
IGL01346:Proser3 APN 7 30549646 missense probably benign 0.21
IGL02465:Proser3 APN 7 30543533 missense possibly damaging 0.87
IGL03178:Proser3 APN 7 30543609 missense probably damaging 0.99
IGL03372:Proser3 APN 7 30543568 missense probably damaging 1.00
K3955:Proser3 UTSW 7 30543499 missense probably damaging 0.96
R0008:Proser3 UTSW 7 30540138 missense probably damaging 0.99
R0008:Proser3 UTSW 7 30540138 missense probably damaging 0.99
R0255:Proser3 UTSW 7 30546417 missense probably damaging 1.00
R0627:Proser3 UTSW 7 30540783 missense probably benign 0.04
R0702:Proser3 UTSW 7 30539530 missense probably benign 0.00
R0883:Proser3 UTSW 7 30540699 missense probably damaging 0.99
R1185:Proser3 UTSW 7 30546147 missense probably benign 0.01
R1457:Proser3 UTSW 7 30539747 critical splice donor site probably null
R1650:Proser3 UTSW 7 30540326 missense probably damaging 0.99
R1697:Proser3 UTSW 7 30540021 missense probably benign 0.00
R3121:Proser3 UTSW 7 30540371 missense probably benign 0.10
R4210:Proser3 UTSW 7 30546100 intron probably benign
R4375:Proser3 UTSW 7 30540671 missense possibly damaging 0.62
R5364:Proser3 UTSW 7 30546148 missense possibly damaging 0.60
R6225:Proser3 UTSW 7 30543728 missense probably damaging 1.00
R6831:Proser3 UTSW 7 30540356 missense probably benign
R7151:Proser3 UTSW 7 30540324 missense possibly damaging 0.79
R7707:Proser3 UTSW 7 30539791 missense probably benign 0.27
R7748:Proser3 UTSW 7 30540072 missense possibly damaging 0.90
X0028:Proser3 UTSW 7 30540762 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CAGAGATGTACTGGACACACC -3'
(R):5'- TCTGAGCATACCTTTGCATGG -3'

Sequencing Primer
(F):5'- ATGGACCTGTCACAGCAGATCTTC -3'
(R):5'- CCTTTGCATGGTGCTTGATAAAC -3'
Posted On2017-06-26