Incidental Mutation 'Z31818:Gan'
ID478401
Institutional Source Beutler Lab
Gene Symbol Gan
Ensembl Gene ENSMUSG00000052557
Gene Namegiant axonal neuropathy
Synonymsgigaxonin
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.101) question?
Stock #Z31818 (F1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location117158135-117215997 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 117195797 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 423 (I423N)
Ref Sequence ENSEMBL: ENSMUSP00000070168 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064488]
Predicted Effect probably damaging
Transcript: ENSMUST00000064488
AA Change: I423N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000070168
Gene: ENSMUSG00000052557
AA Change: I423N

DomainStartEndE-ValueType
BTB 30 129 7.1e-21 SMART
BACK 134 236 2.42e-27 SMART
Kelch 274 326 2.23e-1 SMART
Kelch 327 374 3.41e-11 SMART
Kelch 375 421 1.39e-2 SMART
Kelch 422 468 2.23e-6 SMART
Kelch 528 577 2.09e1 SMART
low complexity region 580 591 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000162997
AA Change: I422N
SMART Domains Protein: ENSMUSP00000124904
Gene: ENSMUSG00000052557
AA Change: I422N

DomainStartEndE-ValueType
BTB 30 129 7.1e-21 SMART
BACK 134 236 2.42e-27 SMART
Kelch 274 326 2.23e-1 SMART
Kelch 327 374 3.41e-11 SMART
Kelch 375 421 1.39e-2 SMART
Kelch 422 468 2.23e-6 SMART
Kelch 528 577 2.09e1 SMART
low complexity region 580 591 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 96.9%
  • 20x: 89.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytoskeletal BTB/kelch (Broad-Complex, Tramtrack and Bric a brac) repeat family. The encoded protein plays a role in neurofilament architecture and is involved in mediating the ubiquitination and degradation of some proteins. Defects in this gene are a cause of giant axonal neuropathy (GAN). [provided by RefSeq, Oct 2008]
PHENOTYPE: Null homozygotes display some muscular atrophy and motor neuron degeneration with the severity of these symptoms depending on genotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 14 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Dmrtc2 C A 7: 24,877,158 P336T probably benign Het
Flt3 C T 5: 147,366,918 probably null Het
Fndc5 G A 4: 129,139,349 D70N probably damaging Het
Itpr3 T G 17: 27,095,478 L634R probably damaging Het
Ndufb5 T A 3: 32,746,461 M74K probably benign Het
Olfr1160 A T 2: 88,005,890 L287* probably null Het
Osbpl6 A G 2: 76,555,082 R287G probably damaging Het
Pkd1l3 A C 8: 109,669,292 N2098T probably damaging Het
Proser3 G A 7: 30,546,365 P97L possibly damaging Het
Rag2 G A 2: 101,630,805 A487T probably damaging Het
Sorl1 A T 9: 42,041,596 C716* probably null Het
Ugt1a6b T C 1: 88,107,155 Y72H probably benign Het
Vmn2r74 T C 7: 85,955,521 probably null Het
Vps13a C T 19: 16,780,754 V6M possibly damaging Het
Other mutations in Gan
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00581:Gan APN 8 117193324 missense probably damaging 0.98
IGL01132:Gan APN 8 117196444 splice site probably benign
IGL01622:Gan APN 8 117187178 missense probably damaging 1.00
IGL01623:Gan APN 8 117187178 missense probably damaging 1.00
IGL03093:Gan APN 8 117183575 missense probably benign
R1534:Gan UTSW 8 117187429 missense probably benign 0.04
R1795:Gan UTSW 8 117196460 missense possibly damaging 0.57
R2027:Gan UTSW 8 117187499 critical splice donor site probably null
R2967:Gan UTSW 8 117183526 missense probably damaging 0.98
R3906:Gan UTSW 8 117194134 missense probably damaging 1.00
R4735:Gan UTSW 8 117194231 missense probably damaging 0.98
R5985:Gan UTSW 8 117195818 missense possibly damaging 0.89
R6027:Gan UTSW 8 117158295 missense probably damaging 1.00
R7002:Gan UTSW 8 117195847 missense possibly damaging 0.89
R7133:Gan UTSW 8 117187230 nonsense probably null
X0023:Gan UTSW 8 117190384 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CTGGGTCATGTTAGACAGCATC -3'
(R):5'- GTACCTGCAATGCTCTGTGC -3'

Sequencing Primer
(F):5'- CATGTTAGACAGCATCATGGTTTTGC -3'
(R):5'- GTACCTGCAATGCTCTGTGCTATATG -3'
Posted On2017-06-26