Incidental Mutation 'Z31818:Gan'
ID 478401
Institutional Source Beutler Lab
Gene Symbol Gan
Ensembl Gene ENSMUSG00000052557
Gene Name giant axonal neuropathy
Synonyms gigaxonin
Accession Numbers
Essential gene? Probably non essential (E-score: 0.105) question?
Stock # Z31818 (F1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 117884720-117932573 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 117922536 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 423 (I423N)
Ref Sequence ENSEMBL: ENSMUSP00000070168 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064488]
AlphaFold Q8CA72
Predicted Effect probably damaging
Transcript: ENSMUST00000064488
AA Change: I423N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000070168
Gene: ENSMUSG00000052557
AA Change: I423N

DomainStartEndE-ValueType
BTB 30 129 7.1e-21 SMART
BACK 134 236 2.42e-27 SMART
Kelch 274 326 2.23e-1 SMART
Kelch 327 374 3.41e-11 SMART
Kelch 375 421 1.39e-2 SMART
Kelch 422 468 2.23e-6 SMART
Kelch 528 577 2.09e1 SMART
low complexity region 580 591 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000162997
AA Change: I422N
SMART Domains Protein: ENSMUSP00000124904
Gene: ENSMUSG00000052557
AA Change: I422N

DomainStartEndE-ValueType
BTB 30 129 7.1e-21 SMART
BACK 134 236 2.42e-27 SMART
Kelch 274 326 2.23e-1 SMART
Kelch 327 374 3.41e-11 SMART
Kelch 375 421 1.39e-2 SMART
Kelch 422 468 2.23e-6 SMART
Kelch 528 577 2.09e1 SMART
low complexity region 580 591 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 96.9%
  • 20x: 89.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytoskeletal BTB/kelch (Broad-Complex, Tramtrack and Bric a brac) repeat family. The encoded protein plays a role in neurofilament architecture and is involved in mediating the ubiquitination and degradation of some proteins. Defects in this gene are a cause of giant axonal neuropathy (GAN). [provided by RefSeq, Oct 2008]
PHENOTYPE: Null homozygotes display some muscular atrophy and motor neuron degeneration with the severity of these symptoms depending on genotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 14 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Dmrtc2 C A 7: 24,576,583 (GRCm39) P336T probably benign Het
Flt3 C T 5: 147,303,728 (GRCm39) probably null Het
Fndc5 G A 4: 129,033,142 (GRCm39) D70N probably damaging Het
Itpr3 T G 17: 27,314,452 (GRCm39) L634R probably damaging Het
Ndufb5 T A 3: 32,800,610 (GRCm39) M74K probably benign Het
Or9m1b A T 2: 87,836,234 (GRCm39) L287* probably null Het
Osbpl6 A G 2: 76,385,426 (GRCm39) R287G probably damaging Het
Pkd1l3 A C 8: 110,395,924 (GRCm39) N2098T probably damaging Het
Proser3 G A 7: 30,245,790 (GRCm39) P97L possibly damaging Het
Rag2 G A 2: 101,461,150 (GRCm39) A487T probably damaging Het
Sorl1 A T 9: 41,952,892 (GRCm39) C716* probably null Het
Ugt1a6b T C 1: 88,034,877 (GRCm39) Y72H probably benign Het
Vmn2r74 T C 7: 85,604,729 (GRCm39) probably null Het
Vps13a C T 19: 16,758,118 (GRCm39) V6M possibly damaging Het
Other mutations in Gan
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00581:Gan APN 8 117,920,063 (GRCm39) missense probably damaging 0.98
IGL01132:Gan APN 8 117,923,183 (GRCm39) splice site probably benign
IGL01622:Gan APN 8 117,913,917 (GRCm39) missense probably damaging 1.00
IGL01623:Gan APN 8 117,913,917 (GRCm39) missense probably damaging 1.00
IGL03093:Gan APN 8 117,910,314 (GRCm39) missense probably benign
R1534:Gan UTSW 8 117,914,168 (GRCm39) missense probably benign 0.04
R1795:Gan UTSW 8 117,923,199 (GRCm39) missense possibly damaging 0.57
R2027:Gan UTSW 8 117,914,238 (GRCm39) critical splice donor site probably null
R2967:Gan UTSW 8 117,910,265 (GRCm39) missense probably damaging 0.98
R3906:Gan UTSW 8 117,920,873 (GRCm39) missense probably damaging 1.00
R4735:Gan UTSW 8 117,920,970 (GRCm39) missense probably damaging 0.98
R5985:Gan UTSW 8 117,922,557 (GRCm39) missense possibly damaging 0.89
R6027:Gan UTSW 8 117,885,034 (GRCm39) missense probably damaging 1.00
R7002:Gan UTSW 8 117,922,586 (GRCm39) missense possibly damaging 0.89
R7133:Gan UTSW 8 117,913,969 (GRCm39) nonsense probably null
R8401:Gan UTSW 8 117,910,242 (GRCm39) missense possibly damaging 0.83
R8834:Gan UTSW 8 117,885,031 (GRCm39) missense
R9623:Gan UTSW 8 117,914,219 (GRCm39) missense probably damaging 1.00
X0023:Gan UTSW 8 117,917,123 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CTGGGTCATGTTAGACAGCATC -3'
(R):5'- GTACCTGCAATGCTCTGTGC -3'

Sequencing Primer
(F):5'- CATGTTAGACAGCATCATGGTTTTGC -3'
(R):5'- GTACCTGCAATGCTCTGTGCTATATG -3'
Posted On 2017-06-26