Incidental Mutation 'R6002:Zswim2'
ID478410
Institutional Source Beutler Lab
Gene Symbol Zswim2
Ensembl Gene ENSMUSG00000034552
Gene Namezinc finger SWIM-type containing 2
Synonyms4933437F18Rik, MEX, 1700025P14Rik
MMRRC Submission 044181-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R6002 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location83915079-83941228 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 83915688 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Tyrosine at position 469 (D469Y)
Ref Sequence ENSEMBL: ENSMUSP00000044913 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038223] [ENSMUST00000152829]
Predicted Effect probably damaging
Transcript: ENSMUST00000038223
AA Change: D469Y

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000044913
Gene: ENSMUSG00000034552
AA Change: D469Y

DomainStartEndE-ValueType
Pfam:SWIM 54 87 1.4e-7 PFAM
RING 147 198 8.3e-5 SMART
ZnF_ZZ 229 273 1.8e-5 SMART
RING 344 385 1.3e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000152829
SMART Domains Protein: ENSMUSP00000119439
Gene: ENSMUSG00000034552

DomainStartEndE-ValueType
Pfam:SWIM 54 87 1.6e-10 PFAM
RING 147 198 1.69e-2 SMART
ZnF_ZZ 229 273 3.65e-3 SMART
Blast:RING 344 365 3e-6 BLAST
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 96.6%
  • 20x: 88.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik T A 2: 68,662,424 probably null Het
Adam28 A G 14: 68,642,062 L179P probably benign Het
Amer2 G T 14: 60,378,782 G142V possibly damaging Het
Ap2a1 A G 7: 44,904,395 probably null Het
Arhgap32 A G 9: 32,256,979 T753A probably benign Het
Capsl A G 15: 9,461,788 D90G probably damaging Het
Cd96 A T 16: 46,117,986 S39T possibly damaging Het
Cdx2 T A 5: 147,303,234 T211S probably damaging Het
Chd9 A G 8: 90,978,887 Y251C probably damaging Het
Chrna6 C T 8: 27,406,746 V368I probably benign Het
Coro1a G T 7: 126,703,080 Q32K probably benign Het
Cps1 T A 1: 67,172,755 V694E possibly damaging Het
Eif3h A G 15: 51,799,276 Y125H probably benign Het
Fbxw22 A C 9: 109,381,682 Y420* probably null Het
Fgf21 T C 7: 45,615,227 Y27C probably benign Het
Gm7356 A G 17: 14,000,739 S343P probably benign Het
Hmcn2 A G 2: 31,420,309 D3305G probably damaging Het
Kdm4c T A 4: 74,404,969 F1046Y possibly damaging Het
Klk1b27 T A 7: 44,055,690 W94R probably benign Het
Nwd2 A T 5: 63,804,800 M576L probably benign Het
Olfr1484 T C 19: 13,585,417 probably benign Het
Olfr159 T C 4: 43,770,063 H316R probably benign Het
Olfr463 A T 11: 87,893,807 V39E probably damaging Het
Olfr474 A G 7: 107,955,169 H176R probably damaging Het
Pappa T A 4: 65,297,408 V1184D probably damaging Het
Pcyox1 T A 6: 86,392,182 M152L probably benign Het
Pdha2 A G 3: 141,211,696 V17A probably benign Het
Pi4k2b A T 5: 52,756,905 I328L probably benign Het
Ppp1r13l T C 7: 19,377,970 F814L probably benign Het
Prag1 A T 8: 36,104,183 H640L probably benign Het
Prl5a1 T C 13: 28,145,482 I48T probably benign Het
Rabgap1 A G 2: 37,473,602 T132A probably benign Het
Sec31b T C 19: 44,535,764 I146V probably benign Het
Slc30a9 A G 5: 67,342,117 Y306C probably damaging Het
Stat3 A G 11: 100,903,743 S247P probably benign Het
Tbc1d1 C A 5: 64,333,433 L747I probably damaging Het
Tbc1d24 A T 17: 24,183,787 M1K probably null Het
Ttc30a1 T C 2: 75,980,777 T321A possibly damaging Het
Vezt A C 10: 94,000,474 V104G probably damaging Het
Zbtb41 A G 1: 139,423,659 D170G probably damaging Het
Other mutations in Zswim2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00844:Zswim2 APN 2 83923771 missense probably benign 0.00
IGL01140:Zswim2 APN 2 83915328 missense probably benign 0.06
IGL01362:Zswim2 APN 2 83915346 missense probably benign 0.09
IGL01768:Zswim2 APN 2 83917957 missense probably benign 0.00
IGL02166:Zswim2 APN 2 83915406 nonsense probably null
IGL02187:Zswim2 APN 2 83923638 missense probably damaging 0.98
IGL02239:Zswim2 APN 2 83938763 nonsense probably null
IGL02629:Zswim2 APN 2 83925209 missense possibly damaging 0.94
R0609:Zswim2 UTSW 2 83923659 missense probably benign 0.02
R0943:Zswim2 UTSW 2 83917998 missense possibly damaging 0.88
R0946:Zswim2 UTSW 2 83923759 missense probably benign 0.10
R1006:Zswim2 UTSW 2 83915393 missense probably damaging 0.97
R1191:Zswim2 UTSW 2 83923695 missense possibly damaging 0.60
R1309:Zswim2 UTSW 2 83938756 missense probably damaging 1.00
R1549:Zswim2 UTSW 2 83923748 missense probably benign 0.24
R1563:Zswim2 UTSW 2 83915282 missense possibly damaging 0.71
R1739:Zswim2 UTSW 2 83915340 nonsense probably null
R1994:Zswim2 UTSW 2 83915663 missense possibly damaging 0.95
R4039:Zswim2 UTSW 2 83915994 missense probably damaging 1.00
R4645:Zswim2 UTSW 2 83915547 missense probably benign 0.00
R4738:Zswim2 UTSW 2 83915395 missense probably benign 0.16
R4855:Zswim2 UTSW 2 83916843 critical splice donor site probably null
R4933:Zswim2 UTSW 2 83925227 missense probably damaging 1.00
R4963:Zswim2 UTSW 2 83925110 missense probably damaging 1.00
R5153:Zswim2 UTSW 2 83939666 missense possibly damaging 0.75
R5401:Zswim2 UTSW 2 83925245 missense possibly damaging 0.94
R5698:Zswim2 UTSW 2 83925183 missense possibly damaging 0.92
R6396:Zswim2 UTSW 2 83923718 missense probably damaging 1.00
R6447:Zswim2 UTSW 2 83915113 unclassified probably null
R6646:Zswim2 UTSW 2 83915784 nonsense probably null
R6717:Zswim2 UTSW 2 83915409 missense probably benign 0.02
R6735:Zswim2 UTSW 2 83923761 missense probably benign 0.04
R6830:Zswim2 UTSW 2 83939684 missense probably damaging 1.00
R7056:Zswim2 UTSW 2 83920748 critical splice acceptor site probably null
R7088:Zswim2 UTSW 2 83915727 nonsense probably null
R7383:Zswim2 UTSW 2 83915328 missense possibly damaging 0.95
R7440:Zswim2 UTSW 2 83920719 missense probably damaging 1.00
R7747:Zswim2 UTSW 2 83915607 missense probably damaging 0.97
X0018:Zswim2 UTSW 2 83941094 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CCCTTCCAGTGAGACAAATAATG -3'
(R):5'- TCTGATCTGGAAAGGCATAGC -3'

Sequencing Primer
(F):5'- ACAAATAATGTTCTTATGAGGAAGGG -3'
(R):5'- GCACATCAGTTGGCTTCAAG -3'
Posted On2017-06-26