Incidental Mutation 'R6002:Coro1a'
ID478426
Institutional Source Beutler Lab
Gene Symbol Coro1a
Ensembl Gene ENSMUSG00000030707
Gene Namecoronin, actin binding protein 1A
SynonymsClabp, Lmb3, coronin 1, p57
MMRRC Submission 044181-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6002 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location126699773-126707787 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 126703080 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 32 (Q32K)
Ref Sequence ENSEMBL: ENSMUSP00000134123 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032949] [ENSMUST00000106364] [ENSMUST00000131415] [ENSMUST00000135087] [ENSMUST00000173108] [ENSMUST00000173116] [ENSMUST00000205515]
Predicted Effect probably benign
Transcript: ENSMUST00000032949
AA Change: Q32K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000032949
Gene: ENSMUSG00000030707
AA Change: Q32K

DomainStartEndE-ValueType
DUF1899 4 68 1.6e-33 SMART
WD40 67 110 1.39e-7 SMART
WD40 120 160 2.42e-7 SMART
WD40 163 204 6.09e-4 SMART
DUF1900 258 392 1.23e-89 SMART
PDB:2AKF|C 430 461 3e-13 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000106364
AA Change: Q32K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000101972
Gene: ENSMUSG00000030707
AA Change: Q32K

DomainStartEndE-ValueType
DUF1899 4 68 1.6e-33 SMART
WD40 67 110 1.39e-7 SMART
WD40 120 160 2.42e-7 SMART
WD40 163 204 6.09e-4 SMART
DUF1900 258 392 1.23e-89 SMART
Pfam:Trimer_CC 410 461 4.1e-32 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123511
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126193
Predicted Effect probably benign
Transcript: ENSMUST00000131415
AA Change: Q32K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000117931
Gene: ENSMUSG00000030707
AA Change: Q32K

DomainStartEndE-ValueType
DUF1899 4 68 1.6e-33 SMART
WD40 67 110 1.39e-7 SMART
WD40 120 160 2.42e-7 SMART
WD40 163 204 6.09e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133718
Predicted Effect probably benign
Transcript: ENSMUST00000135087
AA Change: Q32K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000115960
Gene: ENSMUSG00000030707
AA Change: Q32K

DomainStartEndE-ValueType
DUF1899 4 68 1.6e-33 SMART
WD40 67 110 1.39e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140896
Predicted Effect probably benign
Transcript: ENSMUST00000173108
AA Change: Q32K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000134123
Gene: ENSMUSG00000030707
AA Change: Q32K

DomainStartEndE-ValueType
DUF1899 4 68 1.6e-33 SMART
WD40 67 110 1.39e-7 SMART
WD40 120 160 2.42e-7 SMART
WD40 163 204 6.09e-4 SMART
DUF1900 258 365 3.06e-53 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173116
AA Change: Q32K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000133555
Gene: ENSMUSG00000030707
AA Change: Q32K

DomainStartEndE-ValueType
DUF1899 4 68 1.6e-33 SMART
WD40 67 110 1.39e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174579
Predicted Effect probably benign
Transcript: ENSMUST00000205515
AA Change: Q32K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206275
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 96.6%
  • 20x: 88.5%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the WD repeat coronin family. The encoded protein may bind actin and interact with microtubules. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2014]
PHENOTYPE: Mice homozygous for null or hypomorph alleles of this gene display lower peripheral T cell counts resulting from defects in T cell migration and increased rates of apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik T A 2: 68,662,424 probably null Het
Adam28 A G 14: 68,642,062 L179P probably benign Het
Amer2 G T 14: 60,378,782 G142V possibly damaging Het
Ap2a1 A G 7: 44,904,395 probably null Het
Arhgap32 A G 9: 32,256,979 T753A probably benign Het
Capsl A G 15: 9,461,788 D90G probably damaging Het
Cd96 A T 16: 46,117,986 S39T possibly damaging Het
Cdx2 T A 5: 147,303,234 T211S probably damaging Het
Chd9 A G 8: 90,978,887 Y251C probably damaging Het
Chrna6 C T 8: 27,406,746 V368I probably benign Het
Cps1 T A 1: 67,172,755 V694E possibly damaging Het
Eif3h A G 15: 51,799,276 Y125H probably benign Het
Fbxw22 A C 9: 109,381,682 Y420* probably null Het
Fgf21 T C 7: 45,615,227 Y27C probably benign Het
Gm7356 A G 17: 14,000,739 S343P probably benign Het
Hmcn2 A G 2: 31,420,309 D3305G probably damaging Het
Kdm4c T A 4: 74,404,969 F1046Y possibly damaging Het
Klk1b27 T A 7: 44,055,690 W94R probably benign Het
Nwd2 A T 5: 63,804,800 M576L probably benign Het
Olfr1484 T C 19: 13,585,417 probably benign Het
Olfr159 T C 4: 43,770,063 H316R probably benign Het
Olfr463 A T 11: 87,893,807 V39E probably damaging Het
Olfr474 A G 7: 107,955,169 H176R probably damaging Het
Pappa T A 4: 65,297,408 V1184D probably damaging Het
Pcyox1 T A 6: 86,392,182 M152L probably benign Het
Pdha2 A G 3: 141,211,696 V17A probably benign Het
Pi4k2b A T 5: 52,756,905 I328L probably benign Het
Ppp1r13l T C 7: 19,377,970 F814L probably benign Het
Prag1 A T 8: 36,104,183 H640L probably benign Het
Prl5a1 T C 13: 28,145,482 I48T probably benign Het
Rabgap1 A G 2: 37,473,602 T132A probably benign Het
Sec31b T C 19: 44,535,764 I146V probably benign Het
Slc30a9 A G 5: 67,342,117 Y306C probably damaging Het
Stat3 A G 11: 100,903,743 S247P probably benign Het
Tbc1d1 C A 5: 64,333,433 L747I probably damaging Het
Tbc1d24 A T 17: 24,183,787 M1K probably null Het
Ttc30a1 T C 2: 75,980,777 T321A possibly damaging Het
Vezt A C 10: 94,000,474 V104G probably damaging Het
Zbtb41 A G 1: 139,423,659 D170G probably damaging Het
Zswim2 C A 2: 83,915,688 D469Y probably damaging Het
Other mutations in Coro1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01445:Coro1a APN 7 126701529 missense probably benign 0.00
IGL02307:Coro1a APN 7 126701564 missense probably damaging 1.00
IGL02380:Coro1a APN 7 126703116 nonsense probably null
coralina UTSW 7 126703049 missense probably damaging 1.00
holiday UTSW 7 126700644 splice site probably null
R0009:Coro1a UTSW 7 126701413 splice site probably benign
R0009:Coro1a UTSW 7 126701413 splice site probably benign
R0394:Coro1a UTSW 7 126700640 missense probably benign 0.01
R1275:Coro1a UTSW 7 126700583 critical splice donor site probably null
R1552:Coro1a UTSW 7 126699952 missense probably benign 0.13
R1598:Coro1a UTSW 7 126701692 missense possibly damaging 0.71
R1618:Coro1a UTSW 7 126701547 missense probably benign 0.05
R2116:Coro1a UTSW 7 126702022 missense probably damaging 1.00
R4591:Coro1a UTSW 7 126702992 missense probably damaging 1.00
R5159:Coro1a UTSW 7 126703049 missense probably damaging 1.00
R5261:Coro1a UTSW 7 126700644 splice site probably null
R7237:Coro1a UTSW 7 126700306 missense probably benign
R7560:Coro1a UTSW 7 126703134 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGCCCTGTCCCATTTTACAG -3'
(R):5'- AAGCTGTCAGTCATGGTCAGG -3'

Sequencing Primer
(F):5'- AGTCAGCTACTGAGGACCC -3'
(R):5'- ATGCTGGAACCCTCAAGGC -3'
Posted On2017-06-26