Incidental Mutation 'R6002:Olfr463'
ID478433
Institutional Source Beutler Lab
Gene Symbol Olfr463
Ensembl Gene ENSMUSG00000093920
Gene Nameolfactory receptor 463
SynonymsGA_x6K02T2PAEV-9540823-9539888, MOR240-1
MMRRC Submission 044181-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.880) question?
Stock #R6002 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location87892618-87897387 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 87893807 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 39 (V39E)
Ref Sequence ENSEMBL: ENSMUSP00000149255 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049743] [ENSMUST00000081417] [ENSMUST00000213672] [ENSMUST00000213928] [ENSMUST00000215150] [ENSMUST00000217095]
Predicted Effect probably benign
Transcript: ENSMUST00000049743
SMART Domains Protein: ENSMUSP00000055334
Gene: ENSMUSG00000093839

DomainStartEndE-ValueType
Pfam:7tm_4 31 305 1.2e-40 PFAM
Pfam:7tm_1 41 287 1.8e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000081417
AA Change: V39E

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000080146
Gene: ENSMUSG00000093920
AA Change: V39E

DomainStartEndE-ValueType
Pfam:7tm_4 31 304 6.3e-41 PFAM
Pfam:7tm_1 41 287 8.6e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213672
Predicted Effect probably benign
Transcript: ENSMUST00000213928
Predicted Effect probably damaging
Transcript: ENSMUST00000215150
AA Change: V39E

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000217095
AA Change: V39E

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 96.6%
  • 20x: 88.5%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik T A 2: 68,662,424 probably null Het
Adam28 A G 14: 68,642,062 L179P probably benign Het
Amer2 G T 14: 60,378,782 G142V possibly damaging Het
Ap2a1 A G 7: 44,904,395 probably null Het
Arhgap32 A G 9: 32,256,979 T753A probably benign Het
Capsl A G 15: 9,461,788 D90G probably damaging Het
Cd96 A T 16: 46,117,986 S39T possibly damaging Het
Cdx2 T A 5: 147,303,234 T211S probably damaging Het
Chd9 A G 8: 90,978,887 Y251C probably damaging Het
Chrna6 C T 8: 27,406,746 V368I probably benign Het
Coro1a G T 7: 126,703,080 Q32K probably benign Het
Cps1 T A 1: 67,172,755 V694E possibly damaging Het
Eif3h A G 15: 51,799,276 Y125H probably benign Het
Fbxw22 A C 9: 109,381,682 Y420* probably null Het
Fgf21 T C 7: 45,615,227 Y27C probably benign Het
Gm7356 A G 17: 14,000,739 S343P probably benign Het
Hmcn2 A G 2: 31,420,309 D3305G probably damaging Het
Kdm4c T A 4: 74,404,969 F1046Y possibly damaging Het
Klk1b27 T A 7: 44,055,690 W94R probably benign Het
Nwd2 A T 5: 63,804,800 M576L probably benign Het
Olfr1484 T C 19: 13,585,417 probably benign Het
Olfr159 T C 4: 43,770,063 H316R probably benign Het
Olfr474 A G 7: 107,955,169 H176R probably damaging Het
Pappa T A 4: 65,297,408 V1184D probably damaging Het
Pcyox1 T A 6: 86,392,182 M152L probably benign Het
Pdha2 A G 3: 141,211,696 V17A probably benign Het
Pi4k2b A T 5: 52,756,905 I328L probably benign Het
Ppp1r13l T C 7: 19,377,970 F814L probably benign Het
Prag1 A T 8: 36,104,183 H640L probably benign Het
Prl5a1 T C 13: 28,145,482 I48T probably benign Het
Rabgap1 A G 2: 37,473,602 T132A probably benign Het
Sec31b T C 19: 44,535,764 I146V probably benign Het
Slc30a9 A G 5: 67,342,117 Y306C probably damaging Het
Stat3 A G 11: 100,903,743 S247P probably benign Het
Tbc1d1 C A 5: 64,333,433 L747I probably damaging Het
Tbc1d24 A T 17: 24,183,787 M1K probably null Het
Ttc30a1 T C 2: 75,980,777 T321A possibly damaging Het
Vezt A C 10: 94,000,474 V104G probably damaging Het
Zbtb41 A G 1: 139,423,659 D170G probably damaging Het
Zswim2 C A 2: 83,915,688 D469Y probably damaging Het
Other mutations in Olfr463
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00234:Olfr463 APN 11 87893365 missense possibly damaging 0.46
IGL00481:Olfr463 APN 11 87893621 missense possibly damaging 0.52
R0463:Olfr463 UTSW 11 87893196 missense probably damaging 1.00
R0608:Olfr463 UTSW 11 87893196 missense probably damaging 1.00
R2984:Olfr463 UTSW 11 87893746 missense possibly damaging 0.90
R3055:Olfr463 UTSW 11 87893372 missense possibly damaging 0.95
R5276:Olfr463 UTSW 11 87893192 missense probably damaging 1.00
R5517:Olfr463 UTSW 11 87893066 missense probably damaging 1.00
R5540:Olfr463 UTSW 11 87893685 nonsense probably null
R5934:Olfr463 UTSW 11 87893223 missense possibly damaging 0.73
R6602:Olfr463 UTSW 11 87893652 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GCGGTCATAAGCCATTACTGAG -3'
(R):5'- TCACTTCATGCACTTGGATCG -3'

Sequencing Primer
(F):5'- AGATCTGTACCATGCAGCCTCG -3'
(R):5'- ATGCACTTGGATCGGTCAGC -3'
Posted On2017-06-26