Incidental Mutation 'R6002:Adam28'
ID478437
Institutional Source Beutler Lab
Gene Symbol Adam28
Ensembl Gene ENSMUSG00000014725
Gene Namea disintegrin and metallopeptidase domain 28
SynonymsD430033C21Rik, C130072N01Rik, MDC-L, Dtgn1
MMRRC Submission 044181-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.255) question?
Stock #R6002 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location68606027-68655842 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 68642062 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 179 (L179P)
Ref Sequence ENSEMBL: ENSMUSP00000153354 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022642] [ENSMUST00000111072] [ENSMUST00000224039]
Predicted Effect probably benign
Transcript: ENSMUST00000022642
AA Change: L179P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000022642
Gene: ENSMUSG00000014725
AA Change: L179P

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Pep_M12B_propep 31 158 5.5e-34 PFAM
Pfam:Reprolysin_4 205 387 1.5e-14 PFAM
Pfam:Reprolysin_5 205 388 9.7e-19 PFAM
Pfam:Reprolysin 206 402 5.6e-70 PFAM
Pfam:Reprolysin_2 226 392 1e-16 PFAM
Pfam:Reprolysin_3 230 353 1.2e-21 PFAM
DISIN 419 494 2.1e-36 SMART
ACR 495 623 1.84e-52 SMART
EGF 631 660 3.01e0 SMART
transmembrane domain 667 689 N/A INTRINSIC
low complexity region 738 753 N/A INTRINSIC
low complexity region 757 765 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111072
AA Change: L179P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000106701
Gene: ENSMUSG00000014725
AA Change: L179P

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Pep_M12B_propep 31 158 5.3e-34 PFAM
Pfam:Reprolysin_4 205 387 1.5e-14 PFAM
Pfam:Reprolysin_5 205 388 9.3e-19 PFAM
Pfam:Reprolysin 206 402 5.3e-70 PFAM
Pfam:Reprolysin_2 226 392 9.9e-17 PFAM
Pfam:Reprolysin_3 230 353 1.1e-21 PFAM
DISIN 419 494 2.1e-36 SMART
ACR 495 623 1.84e-52 SMART
EGF 631 660 3.01e0 SMART
transmembrane domain 667 689 N/A INTRINSIC
low complexity region 738 753 N/A INTRINSIC
low complexity region 757 765 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000224039
AA Change: L179P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224131
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 96.6%
  • 20x: 88.5%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the ADAM (a disintegrin and metalloprotease domain) family. Members of this family are typically membrane-anchored, although a form of this protein may be secreted. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that is proteolytically processed to generate a mature protein product. This protein may bind to integrins and regulate lymphocyte migration by enhancing cell adhesion. [provided by RefSeq, Aug 2015]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik T A 2: 68,662,424 probably null Het
Amer2 G T 14: 60,378,782 G142V possibly damaging Het
Ap2a1 A G 7: 44,904,395 probably null Het
Arhgap32 A G 9: 32,256,979 T753A probably benign Het
Capsl A G 15: 9,461,788 D90G probably damaging Het
Cd96 A T 16: 46,117,986 S39T possibly damaging Het
Cdx2 T A 5: 147,303,234 T211S probably damaging Het
Chd9 A G 8: 90,978,887 Y251C probably damaging Het
Chrna6 C T 8: 27,406,746 V368I probably benign Het
Coro1a G T 7: 126,703,080 Q32K probably benign Het
Cps1 T A 1: 67,172,755 V694E possibly damaging Het
Eif3h A G 15: 51,799,276 Y125H probably benign Het
Fbxw22 A C 9: 109,381,682 Y420* probably null Het
Fgf21 T C 7: 45,615,227 Y27C probably benign Het
Gm7356 A G 17: 14,000,739 S343P probably benign Het
Hmcn2 A G 2: 31,420,309 D3305G probably damaging Het
Kdm4c T A 4: 74,404,969 F1046Y possibly damaging Het
Klk1b27 T A 7: 44,055,690 W94R probably benign Het
Nwd2 A T 5: 63,804,800 M576L probably benign Het
Olfr1484 T C 19: 13,585,417 probably benign Het
Olfr159 T C 4: 43,770,063 H316R probably benign Het
Olfr463 A T 11: 87,893,807 V39E probably damaging Het
Olfr474 A G 7: 107,955,169 H176R probably damaging Het
Pappa T A 4: 65,297,408 V1184D probably damaging Het
Pcyox1 T A 6: 86,392,182 M152L probably benign Het
Pdha2 A G 3: 141,211,696 V17A probably benign Het
Pi4k2b A T 5: 52,756,905 I328L probably benign Het
Ppp1r13l T C 7: 19,377,970 F814L probably benign Het
Prag1 A T 8: 36,104,183 H640L probably benign Het
Prl5a1 T C 13: 28,145,482 I48T probably benign Het
Rabgap1 A G 2: 37,473,602 T132A probably benign Het
Sec31b T C 19: 44,535,764 I146V probably benign Het
Slc30a9 A G 5: 67,342,117 Y306C probably damaging Het
Stat3 A G 11: 100,903,743 S247P probably benign Het
Tbc1d1 C A 5: 64,333,433 L747I probably damaging Het
Tbc1d24 A T 17: 24,183,787 M1K probably null Het
Ttc30a1 T C 2: 75,980,777 T321A possibly damaging Het
Vezt A C 10: 94,000,474 V104G probably damaging Het
Zbtb41 A G 1: 139,423,659 D170G probably damaging Het
Zswim2 C A 2: 83,915,688 D469Y probably damaging Het
Other mutations in Adam28
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Adam28 APN 14 68622120 missense possibly damaging 0.47
IGL00654:Adam28 APN 14 68649428 missense probably benign 0.00
IGL01021:Adam28 APN 14 68642114 missense probably benign
IGL01099:Adam28 APN 14 68637329 critical splice donor site probably null
IGL01349:Adam28 APN 14 68611006 missense probably benign 0.01
IGL01744:Adam28 APN 14 68607507 missense probably benign 0.07
IGL01805:Adam28 APN 14 68642091 missense probably benign 0.09
IGL02007:Adam28 APN 14 68633219 missense possibly damaging 0.69
IGL02828:Adam28 APN 14 68646870 missense possibly damaging 0.46
IGL03180:Adam28 APN 14 68637434 missense probably damaging 1.00
IGL03355:Adam28 APN 14 68634803 splice site probably benign
IGL02980:Adam28 UTSW 14 68619806 missense probably benign 0.01
PIT4453001:Adam28 UTSW 14 68634876 missense probably benign 0.00
R0184:Adam28 UTSW 14 68637373 missense probably benign 0.33
R0321:Adam28 UTSW 14 68617751 missense probably damaging 0.97
R0329:Adam28 UTSW 14 68617739 missense probably damaging 0.96
R0494:Adam28 UTSW 14 68630792 splice site probably benign
R0605:Adam28 UTSW 14 68606600 unclassified probably benign
R0732:Adam28 UTSW 14 68637347 missense probably benign 0.00
R0959:Adam28 UTSW 14 68607938 missense possibly damaging 0.93
R1319:Adam28 UTSW 14 68609129 missense probably benign 0.28
R1745:Adam28 UTSW 14 68633171 missense probably benign 0.04
R1836:Adam28 UTSW 14 68649421 missense possibly damaging 0.85
R1838:Adam28 UTSW 14 68639210 missense possibly damaging 0.53
R1839:Adam28 UTSW 14 68639210 missense possibly damaging 0.53
R1850:Adam28 UTSW 14 68639195 missense probably benign 0.01
R1912:Adam28 UTSW 14 68644331 missense probably benign 0.24
R2830:Adam28 UTSW 14 68626914 missense possibly damaging 0.65
R2889:Adam28 UTSW 14 68634845 missense possibly damaging 0.85
R3977:Adam28 UTSW 14 68610994 missense probably benign 0.20
R3978:Adam28 UTSW 14 68610994 missense probably benign 0.20
R3979:Adam28 UTSW 14 68610994 missense probably benign 0.20
R4282:Adam28 UTSW 14 68647706 missense possibly damaging 0.92
R4416:Adam28 UTSW 14 68622082 critical splice donor site probably null
R4690:Adam28 UTSW 14 68642048 missense probably benign 0.01
R4724:Adam28 UTSW 14 68626877 missense probably damaging 0.99
R4768:Adam28 UTSW 14 68634815 missense possibly damaging 0.46
R4883:Adam28 UTSW 14 68638103 missense probably damaging 0.99
R5054:Adam28 UTSW 14 68617715 missense probably damaging 1.00
R5710:Adam28 UTSW 14 68609908 missense probably damaging 0.96
R5835:Adam28 UTSW 14 68655681 missense possibly damaging 0.96
R6054:Adam28 UTSW 14 68642152 missense probably benign 0.01
R6349:Adam28 UTSW 14 68633172 missense probably benign 0.29
R6449:Adam28 UTSW 14 68630667 missense probably benign 0.31
R6455:Adam28 UTSW 14 68633208 missense probably damaging 1.00
R6831:Adam28 UTSW 14 68618127 missense probably benign 0.04
R6833:Adam28 UTSW 14 68618127 missense probably benign 0.04
R7212:Adam28 UTSW 14 68637397 missense probably damaging 0.99
R7411:Adam28 UTSW 14 68626947 missense probably damaging 1.00
R7422:Adam28 UTSW 14 68626877 missense probably damaging 1.00
R7516:Adam28 UTSW 14 68630676 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGACACACAGACAGGGTCATG -3'
(R):5'- AGCACTCTGGCTGTACAAC -3'

Sequencing Primer
(F):5'- CAGACAGGGTCATGTATACACATATG -3'
(R):5'- GCGACACCATTGTGCTAAG -3'
Posted On2017-06-26