Incidental Mutation 'R6002:Cd96'
ID478440
Institutional Source Beutler Lab
Gene Symbol Cd96
Ensembl Gene ENSMUSG00000022657
Gene NameCD96 antigen
Synonyms1700109I12Rik, Tactile
MMRRC Submission 044181-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6002 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location46035657-46120251 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 46117986 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 39 (S39T)
Ref Sequence ENSEMBL: ENSMUSP00000023336 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023336]
Predicted Effect possibly damaging
Transcript: ENSMUST00000023336
AA Change: S39T

PolyPhen 2 Score 0.608 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000023336
Gene: ENSMUSG00000022657
AA Change: S39T

DomainStartEndE-ValueType
IG 30 137 1.63e-3 SMART
IG 145 247 1.12e-1 SMART
Blast:IG_like 257 357 3e-14 BLAST
low complexity region 434 448 N/A INTRINSIC
transmembrane domain 535 557 N/A INTRINSIC
low complexity region 571 580 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 96.6%
  • 20x: 88.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the immunoglobulin superfamily. It is a type I membrane protein. The protein may play a role in the adhesive interactions of activated T and NK cells during the late phase of the immune response. It may also function in antigen presentation. Alternative splicing generates multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik T A 2: 68,662,424 probably null Het
Adam28 A G 14: 68,642,062 L179P probably benign Het
Amer2 G T 14: 60,378,782 G142V possibly damaging Het
Ap2a1 A G 7: 44,904,395 probably null Het
Arhgap32 A G 9: 32,256,979 T753A probably benign Het
Capsl A G 15: 9,461,788 D90G probably damaging Het
Cdx2 T A 5: 147,303,234 T211S probably damaging Het
Chd9 A G 8: 90,978,887 Y251C probably damaging Het
Chrna6 C T 8: 27,406,746 V368I probably benign Het
Coro1a G T 7: 126,703,080 Q32K probably benign Het
Cps1 T A 1: 67,172,755 V694E possibly damaging Het
Eif3h A G 15: 51,799,276 Y125H probably benign Het
Fbxw22 A C 9: 109,381,682 Y420* probably null Het
Fgf21 T C 7: 45,615,227 Y27C probably benign Het
Gm7356 A G 17: 14,000,739 S343P probably benign Het
Hmcn2 A G 2: 31,420,309 D3305G probably damaging Het
Kdm4c T A 4: 74,404,969 F1046Y possibly damaging Het
Klk1b27 T A 7: 44,055,690 W94R probably benign Het
Nwd2 A T 5: 63,804,800 M576L probably benign Het
Olfr1484 T C 19: 13,585,417 probably benign Het
Olfr159 T C 4: 43,770,063 H316R probably benign Het
Olfr463 A T 11: 87,893,807 V39E probably damaging Het
Olfr474 A G 7: 107,955,169 H176R probably damaging Het
Pappa T A 4: 65,297,408 V1184D probably damaging Het
Pcyox1 T A 6: 86,392,182 M152L probably benign Het
Pdha2 A G 3: 141,211,696 V17A probably benign Het
Pi4k2b A T 5: 52,756,905 I328L probably benign Het
Ppp1r13l T C 7: 19,377,970 F814L probably benign Het
Prag1 A T 8: 36,104,183 H640L probably benign Het
Prl5a1 T C 13: 28,145,482 I48T probably benign Het
Rabgap1 A G 2: 37,473,602 T132A probably benign Het
Sec31b T C 19: 44,535,764 I146V probably benign Het
Slc30a9 A G 5: 67,342,117 Y306C probably damaging Het
Stat3 A G 11: 100,903,743 S247P probably benign Het
Tbc1d1 C A 5: 64,333,433 L747I probably damaging Het
Tbc1d24 A T 17: 24,183,787 M1K probably null Het
Ttc30a1 T C 2: 75,980,777 T321A possibly damaging Het
Vezt A C 10: 94,000,474 V104G probably damaging Het
Zbtb41 A G 1: 139,423,659 D170G probably damaging Het
Zswim2 C A 2: 83,915,688 D469Y probably damaging Het
Other mutations in Cd96
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Cd96 APN 16 46071799 missense possibly damaging 0.85
IGL00588:Cd96 APN 16 46038554 missense probably benign 0.04
IGL00916:Cd96 APN 16 46041312 missense probably benign 0.07
IGL01080:Cd96 APN 16 46049693 missense possibly damaging 0.67
IGL01538:Cd96 APN 16 46109127 missense possibly damaging 0.67
IGL02350:Cd96 APN 16 46069776 splice site probably benign
IGL02357:Cd96 APN 16 46069776 splice site probably benign
IGL02892:Cd96 APN 16 46049797 critical splice acceptor site probably null
R0119:Cd96 UTSW 16 46038579 splice site probably benign
R0242:Cd96 UTSW 16 46071766 missense possibly damaging 0.88
R0242:Cd96 UTSW 16 46071766 missense possibly damaging 0.88
R0515:Cd96 UTSW 16 46063905 splice site probably benign
R0655:Cd96 UTSW 16 46099119 missense probably benign 0.06
R0684:Cd96 UTSW 16 46117790 missense possibly damaging 0.96
R0838:Cd96 UTSW 16 46117926 missense probably damaging 1.00
R1531:Cd96 UTSW 16 46117806 missense probably benign 0.03
R1664:Cd96 UTSW 16 46118001 missense possibly damaging 0.95
R1791:Cd96 UTSW 16 46117999 nonsense probably null
R1840:Cd96 UTSW 16 46099092 missense probably benign 0.36
R1873:Cd96 UTSW 16 46117972 missense probably damaging 1.00
R2895:Cd96 UTSW 16 46117805 missense probably benign 0.43
R2906:Cd96 UTSW 16 46051487 missense possibly damaging 0.56
R4291:Cd96 UTSW 16 46071749 missense probably damaging 0.98
R5112:Cd96 UTSW 16 46098938 missense probably benign
R5261:Cd96 UTSW 16 46069653 missense probably benign 0.39
R5274:Cd96 UTSW 16 46069703 missense possibly damaging 0.78
R5934:Cd96 UTSW 16 46117903 missense probably benign 0.43
R6758:Cd96 UTSW 16 46118004 missense possibly damaging 0.50
R6992:Cd96 UTSW 16 46049724 missense possibly damaging 0.65
R7239:Cd96 UTSW 16 46109114 missense probably damaging 1.00
R7308:Cd96 UTSW 16 46071734 critical splice donor site probably null
R7316:Cd96 UTSW 16 46069653 missense probably benign 0.39
R7355:Cd96 UTSW 16 46041292 missense possibly damaging 0.51
R7553:Cd96 UTSW 16 46052021 missense probably damaging 1.00
X0017:Cd96 UTSW 16 46049774 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TCTCAGTTTCTGTGGCAGCC -3'
(R):5'- CCATCAGTGACCCTCAGTTAC -3'

Sequencing Primer
(F):5'- CACTTGTGACTCACAGGCATG -3'
(R):5'- GACCCTCAGTTACTTTTTGGACAGAC -3'
Posted On2017-06-26