Incidental Mutation 'R6003:Cnpy1'
ID478455
Institutional Source Beutler Lab
Gene Symbol Cnpy1
Ensembl Gene ENSMUSG00000044681
Gene Namecanopy FGF signaling regulator 1
Synonyms
MMRRC Submission 043252-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6003 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location28200819-28245806 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 28245761 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 16 (T16A)
Ref Sequence ENSEMBL: ENSMUSP00000122171 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000141601]
Predicted Effect probably benign
Transcript: ENSMUST00000141601
AA Change: T16A

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000122171
Gene: ENSMUSG00000044681
AA Change: T16A

DomainStartEndE-ValueType
Pfam:DUF3456 1 86 7.8e-16 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.2%
  • 20x: 90.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cnpy1 is expressed in the midbrain-hindbrain (MHB) boundary in zebrafish, binds FGFR1 (MIM 136350), and plays a role in FGF signaling (Hirate and Okamoto, 2006 [PubMed 16488878]).[supplied by OMIM, Dec 2008]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A4galt T C 15: 83,228,111 E157G probably benign Het
Abcb11 T C 2: 69,243,467 K1238R probably benign Het
Ankar T A 1: 72,698,887 E45D probably damaging Het
Antxrl G T 14: 34,075,635 K522N possibly damaging Het
Ap1m1 A G 8: 72,249,167 Y93C probably damaging Het
As3mt C T 19: 46,708,128 T35M possibly damaging Het
Aspg T C 12: 112,113,042 S85P probably damaging Het
BC030499 T G 11: 78,293,020 probably null Het
Cachd1 T C 4: 100,952,019 S234P possibly damaging Het
Ccdc3 T C 2: 5,141,407 probably null Het
Cope T C 8: 70,304,635 L43P probably benign Het
E2f8 T C 7: 48,870,777 M599V probably benign Het
Eif3a A T 19: 60,766,881 D954E unknown Het
Gfpt1 T A 6: 87,088,248 probably null Het
Ggps1 T G 13: 14,054,002 S145R probably benign Het
Gon4l A G 3: 88,896,093 D1337G probably damaging Het
Gtf2a1l G T 17: 88,694,103 G82V probably damaging Het
Gucy1b1 C A 3: 82,058,277 L87F probably damaging Het
Hoxc9 T C 15: 102,981,879 V76A probably benign Het
Ints2 T C 11: 86,238,468 E460G probably damaging Het
Kdm4b C T 17: 56,396,916 R756W probably damaging Het
Lax1 T A 1: 133,684,096 I34F probably benign Het
Marveld3 A T 8: 109,954,328 C312S probably damaging Het
Ncoa2 T C 1: 13,167,030 D824G possibly damaging Het
Nrxn2 C A 19: 6,498,328 A17D possibly damaging Het
Nup133 A T 8: 123,938,292 I220N probably damaging Het
Nup205 T C 6: 35,212,816 V984A probably benign Het
Nup54 A T 5: 92,422,994 D318E probably damaging Het
Obp2a A T 2: 25,701,139 K94N probably damaging Het
Olfr1469 T C 19: 13,411,039 S157P probably benign Het
Olfr318 A T 11: 58,720,370 I226N probably benign Het
Pappa2 T C 1: 158,936,250 I564V probably benign Het
Parpbp A G 10: 88,133,158 V142A possibly damaging Het
Rdh16f2 A T 10: 127,876,332 R219S probably benign Het
Rfx6 C T 10: 51,708,587 R228C probably damaging Het
Rpap2 A G 5: 107,601,901 probably null Het
Slc15a2 T C 16: 36,754,548 I531V probably benign Het
Srebf1 T C 11: 60,207,104 E58G possibly damaging Het
Tmem214 C A 5: 30,870,724 T96K possibly damaging Het
Usp19 T C 9: 108,496,380 Y691H probably damaging Het
Vmn1r86 C T 7: 13,102,198 W200* probably null Het
Vmn2r8 A T 5: 108,797,382 S786R probably damaging Het
Vps52 T A 17: 33,956,094 M1K probably null Het
Zzef1 T A 11: 72,824,065 probably null Het
Other mutations in Cnpy1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00985:Cnpy1 APN 5 28209154 nonsense probably null
IGL02933:Cnpy1 APN 5 28207121 missense probably benign
R3508:Cnpy1 UTSW 5 28207367 missense probably damaging 1.00
R4851:Cnpy1 UTSW 5 28245740 missense probably benign 0.06
R7649:Cnpy1 UTSW 5 28207284 missense probably benign 0.44
R8412:Cnpy1 UTSW 5 28209208 nonsense probably null
R8416:Cnpy1 UTSW 5 28203425 missense probably benign
Z1177:Cnpy1 UTSW 5 28207209 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- AGATTACTTTGGGTCCCCTAGG -3'
(R):5'- TCTGAGTCAGAGTCCATACACATC -3'

Sequencing Primer
(F):5'- GCAATTTAGAGCTGACACCCTG -3'
(R):5'- TCTCGTTTAGCATGCAGG -3'
Posted On2017-06-26