Incidental Mutation 'R6003:Tmem214'
ID478456
Institutional Source Beutler Lab
Gene Symbol Tmem214
Ensembl Gene ENSMUSG00000038828
Gene Nametransmembrane protein 214
Synonyms
MMRRC Submission 043252-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.423) question?
Stock #R6003 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location30868012-30879180 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 30870724 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 96 (T96K)
Ref Sequence ENSEMBL: ENSMUSP00000144615 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031058] [ENSMUST00000114716] [ENSMUST00000200692] [ENSMUST00000201203]
Predicted Effect probably benign
Transcript: ENSMUST00000031058
SMART Domains Protein: ENSMUSP00000031058
Gene: ENSMUSG00000029166

DomainStartEndE-ValueType
Pfam:CH 14 114 4.1e-10 PFAM
low complexity region 201 214 N/A INTRINSIC
Pfam:EB1 219 257 1.4e-17 PFAM
low complexity region 266 280 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114716
AA Change: T96K

PolyPhen 2 Score 0.209 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000110364
Gene: ENSMUSG00000038828
AA Change: T96K

DomainStartEndE-ValueType
low complexity region 16 36 N/A INTRINSIC
low complexity region 84 94 N/A INTRINSIC
Pfam:DUF2359 172 638 8e-247 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000200692
SMART Domains Protein: ENSMUSP00000143890
Gene: ENSMUSG00000029166

DomainStartEndE-ValueType
Pfam:CH 14 114 2.8e-12 PFAM
low complexity region 186 199 N/A INTRINSIC
Pfam:EB1 204 242 1.6e-21 PFAM
low complexity region 251 265 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000201203
AA Change: T96K

PolyPhen 2 Score 0.522 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000144615
Gene: ENSMUSG00000038828
AA Change: T96K

DomainStartEndE-ValueType
low complexity region 16 36 N/A INTRINSIC
low complexity region 84 94 N/A INTRINSIC
Pfam:DUF2359 217 683 6.9e-246 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201234
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201347
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202008
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202050
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202534
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202774
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202951
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.2%
  • 20x: 90.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A4galt T C 15: 83,228,111 E157G probably benign Het
Abcb11 T C 2: 69,243,467 K1238R probably benign Het
Ankar T A 1: 72,698,887 E45D probably damaging Het
Antxrl G T 14: 34,075,635 K522N possibly damaging Het
Ap1m1 A G 8: 72,249,167 Y93C probably damaging Het
As3mt C T 19: 46,708,128 T35M possibly damaging Het
Aspg T C 12: 112,113,042 S85P probably damaging Het
BC030499 T G 11: 78,293,020 probably null Het
Cachd1 T C 4: 100,952,019 S234P possibly damaging Het
Ccdc3 T C 2: 5,141,407 probably null Het
Cnpy1 T C 5: 28,245,761 T16A probably benign Het
Cope T C 8: 70,304,635 L43P probably benign Het
E2f8 T C 7: 48,870,777 M599V probably benign Het
Eif3a A T 19: 60,766,881 D954E unknown Het
Gfpt1 T A 6: 87,088,248 probably null Het
Ggps1 T G 13: 14,054,002 S145R probably benign Het
Gon4l A G 3: 88,896,093 D1337G probably damaging Het
Gtf2a1l G T 17: 88,694,103 G82V probably damaging Het
Gucy1b1 C A 3: 82,058,277 L87F probably damaging Het
Hoxc9 T C 15: 102,981,879 V76A probably benign Het
Ints2 T C 11: 86,238,468 E460G probably damaging Het
Kdm4b C T 17: 56,396,916 R756W probably damaging Het
Lax1 T A 1: 133,684,096 I34F probably benign Het
Marveld3 A T 8: 109,954,328 C312S probably damaging Het
Ncoa2 T C 1: 13,167,030 D824G possibly damaging Het
Nrxn2 C A 19: 6,498,328 A17D possibly damaging Het
Nup133 A T 8: 123,938,292 I220N probably damaging Het
Nup205 T C 6: 35,212,816 V984A probably benign Het
Nup54 A T 5: 92,422,994 D318E probably damaging Het
Obp2a A T 2: 25,701,139 K94N probably damaging Het
Olfr1469 T C 19: 13,411,039 S157P probably benign Het
Olfr318 A T 11: 58,720,370 I226N probably benign Het
Pappa2 T C 1: 158,936,250 I564V probably benign Het
Parpbp A G 10: 88,133,158 V142A possibly damaging Het
Rdh16f2 A T 10: 127,876,332 R219S probably benign Het
Rfx6 C T 10: 51,708,587 R228C probably damaging Het
Rpap2 A G 5: 107,601,901 probably null Het
Slc15a2 T C 16: 36,754,548 I531V probably benign Het
Srebf1 T C 11: 60,207,104 E58G possibly damaging Het
Usp19 T C 9: 108,496,380 Y691H probably damaging Het
Vmn1r86 C T 7: 13,102,198 W200* probably null Het
Vmn2r8 A T 5: 108,797,382 S786R probably damaging Het
Vps52 T A 17: 33,956,094 M1K probably null Het
Zzef1 T A 11: 72,824,065 probably null Het
Other mutations in Tmem214
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01083:Tmem214 APN 5 30876093 missense probably benign 0.15
IGL02119:Tmem214 APN 5 30872746 missense probably benign 0.01
IGL02123:Tmem214 APN 5 30872746 missense probably benign 0.01
IGL02124:Tmem214 APN 5 30872746 missense probably benign 0.01
IGL02126:Tmem214 APN 5 30872746 missense probably benign 0.01
IGL02186:Tmem214 APN 5 30872746 missense probably benign 0.01
IGL02395:Tmem214 APN 5 30872746 missense probably benign 0.01
IGL02396:Tmem214 APN 5 30872746 missense probably benign 0.01
IGL02397:Tmem214 APN 5 30872746 missense probably benign 0.01
IGL02400:Tmem214 APN 5 30872746 missense probably benign 0.01
IGL02403:Tmem214 APN 5 30872746 missense probably benign 0.01
IGL02404:Tmem214 APN 5 30872746 missense probably benign 0.01
IGL02539:Tmem214 APN 5 30872746 missense probably benign 0.01
IGL02544:Tmem214 APN 5 30872746 missense probably benign 0.01
IGL02934:Tmem214 APN 5 30871544 missense probably benign 0.26
PIT4382001:Tmem214 UTSW 5 30871451 missense possibly damaging 0.89
R0501:Tmem214 UTSW 5 30872532 missense probably damaging 1.00
R0519:Tmem214 UTSW 5 30869668 start codon destroyed probably null 0.98
R0675:Tmem214 UTSW 5 30871825 missense possibly damaging 0.70
R1204:Tmem214 UTSW 5 30875790 missense probably damaging 0.97
R1616:Tmem214 UTSW 5 30871563 nonsense probably null
R2096:Tmem214 UTSW 5 30876370 missense probably damaging 1.00
R2219:Tmem214 UTSW 5 30873631 missense possibly damaging 0.72
R5635:Tmem214 UTSW 5 30871517 missense probably damaging 1.00
R6744:Tmem214 UTSW 5 30874028 missense probably damaging 1.00
R7208:Tmem214 UTSW 5 30870721 missense possibly damaging 0.52
R8155:Tmem214 UTSW 5 30871792 missense possibly damaging 0.56
R8335:Tmem214 UTSW 5 30872122 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- ACTGTACAGTGGGATCTGGG -3'
(R):5'- GCTCACCTATGTTTCTGACAAATACC -3'

Sequencing Primer
(F):5'- ACAGTGGGATCTGGGGTCTTAAG -3'
(R):5'- ACATTCTTTCTATTCTAAGTGCACG -3'
Posted On2017-06-26