Incidental Mutation 'R6003:Nup54'
ID478457
Institutional Source Beutler Lab
Gene Symbol Nup54
Ensembl Gene ENSMUSG00000034826
Gene Namenucleoporin 54
Synonyms54kDa, 3110079L04Rik
MMRRC Submission 043252-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.956) question?
Stock #R6003 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location92415540-92435219 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 92422994 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 318 (D318E)
Ref Sequence ENSEMBL: ENSMUSP00000046540 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038514]
Predicted Effect probably damaging
Transcript: ENSMUST00000038514
AA Change: D318E

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000046540
Gene: ENSMUSG00000034826
AA Change: D318E

DomainStartEndE-ValueType
low complexity region 5 109 N/A INTRINSIC
Pfam:Nup54 303 441 4.8e-49 PFAM
PDB:3T98|C 445 494 2e-26 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142525
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201228
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.2%
  • 20x: 90.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The nuclear envelope creates distinct nuclear and cytoplasmic compartments in eukaryotic cells. It consists of two concentric membranes perforated by nuclear pores, large protein complexes that form aqueous channels to regulate the flow of macromolecules between the nucleus and the cytoplasm. These complexes are composed of at least 100 different polypeptide subunits, many of which belong to the nucleoporin family. This gene encodes a member of the phe-gly (FG) repeat-containing nucleoporin subset. Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jun 2013]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A4galt T C 15: 83,228,111 E157G probably benign Het
Abcb11 T C 2: 69,243,467 K1238R probably benign Het
Ankar T A 1: 72,698,887 E45D probably damaging Het
Antxrl G T 14: 34,075,635 K522N possibly damaging Het
Ap1m1 A G 8: 72,249,167 Y93C probably damaging Het
As3mt C T 19: 46,708,128 T35M possibly damaging Het
Aspg T C 12: 112,113,042 S85P probably damaging Het
BC030499 T G 11: 78,293,020 probably null Het
Cachd1 T C 4: 100,952,019 S234P possibly damaging Het
Ccdc3 T C 2: 5,141,407 probably null Het
Cnpy1 T C 5: 28,245,761 T16A probably benign Het
Cope T C 8: 70,304,635 L43P probably benign Het
E2f8 T C 7: 48,870,777 M599V probably benign Het
Eif3a A T 19: 60,766,881 D954E unknown Het
Gfpt1 T A 6: 87,088,248 probably null Het
Ggps1 T G 13: 14,054,002 S145R probably benign Het
Gon4l A G 3: 88,896,093 D1337G probably damaging Het
Gtf2a1l G T 17: 88,694,103 G82V probably damaging Het
Gucy1b1 C A 3: 82,058,277 L87F probably damaging Het
Hoxc9 T C 15: 102,981,879 V76A probably benign Het
Ints2 T C 11: 86,238,468 E460G probably damaging Het
Kdm4b C T 17: 56,396,916 R756W probably damaging Het
Lax1 T A 1: 133,684,096 I34F probably benign Het
Marveld3 A T 8: 109,954,328 C312S probably damaging Het
Ncoa2 T C 1: 13,167,030 D824G possibly damaging Het
Nrxn2 C A 19: 6,498,328 A17D possibly damaging Het
Nup133 A T 8: 123,938,292 I220N probably damaging Het
Nup205 T C 6: 35,212,816 V984A probably benign Het
Obp2a A T 2: 25,701,139 K94N probably damaging Het
Olfr1469 T C 19: 13,411,039 S157P probably benign Het
Olfr318 A T 11: 58,720,370 I226N probably benign Het
Pappa2 T C 1: 158,936,250 I564V probably benign Het
Parpbp A G 10: 88,133,158 V142A possibly damaging Het
Rdh16f2 A T 10: 127,876,332 R219S probably benign Het
Rfx6 C T 10: 51,708,587 R228C probably damaging Het
Rpap2 A G 5: 107,601,901 probably null Het
Slc15a2 T C 16: 36,754,548 I531V probably benign Het
Srebf1 T C 11: 60,207,104 E58G possibly damaging Het
Tmem214 C A 5: 30,870,724 T96K possibly damaging Het
Usp19 T C 9: 108,496,380 Y691H probably damaging Het
Vmn1r86 C T 7: 13,102,198 W200* probably null Het
Vmn2r8 A T 5: 108,797,382 S786R probably damaging Het
Vps52 T A 17: 33,956,094 M1K probably null Het
Zzef1 T A 11: 72,824,065 probably null Het
Other mutations in Nup54
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00491:Nup54 APN 5 92417485 missense probably benign 0.00
IGL01526:Nup54 APN 5 92417475 missense probably benign 0.12
IGL01924:Nup54 APN 5 92424435 missense probably benign 0.02
IGL02248:Nup54 APN 5 92428329 splice site probably null
IGL02253:Nup54 APN 5 92417451 critical splice donor site probably null
IGL02508:Nup54 APN 5 92417539 nonsense probably null
IGL02721:Nup54 APN 5 92417857 missense possibly damaging 0.96
IGL03150:Nup54 APN 5 92428164 missense probably damaging 1.00
R0189:Nup54 UTSW 5 92422564 missense probably damaging 1.00
R1401:Nup54 UTSW 5 92428221 missense probably damaging 1.00
R1862:Nup54 UTSW 5 92419567 missense possibly damaging 0.75
R3938:Nup54 UTSW 5 92417529 missense probably damaging 1.00
R4171:Nup54 UTSW 5 92417484 missense possibly damaging 0.64
R4574:Nup54 UTSW 5 92425782 missense probably benign 0.17
R5372:Nup54 UTSW 5 92417857 missense probably damaging 1.00
R6191:Nup54 UTSW 5 92424294 missense probably damaging 0.99
R6197:Nup54 UTSW 5 92430804 utr 3 prime probably benign
Predicted Primers PCR Primer
(F):5'- AGCATGCTGCCTTACCATGG -3'
(R):5'- CCCAAAGGTATTAATTCCACTGTCTG -3'

Sequencing Primer
(F):5'- ATGCTGCCTTACCATGGTAGAACTG -3'
(R):5'- AATTCCACTGTCTGTTGCAGATAC -3'
Posted On2017-06-26