Incidental Mutation 'R6003:Ap1m1'
ID478464
Institutional Source Beutler Lab
Gene Symbol Ap1m1
Ensembl Gene ENSMUSG00000003033
Gene Nameadaptor-related protein complex AP-1, mu subunit 1
Synonymsmu1A, [m]1A, Cltnm, AP47, Adtm1A
MMRRC Submission 043252-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6003 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location72240018-72257385 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 72249167 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 93 (Y93C)
Ref Sequence ENSEMBL: ENSMUSP00000148530 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003117] [ENSMUST00000126885] [ENSMUST00000145213] [ENSMUST00000212708] [ENSMUST00000212841] [ENSMUST00000212940]
Predicted Effect probably damaging
Transcript: ENSMUST00000003117
AA Change: Y85C

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000003117
Gene: ENSMUSG00000003033
AA Change: Y85C

DomainStartEndE-ValueType
Pfam:Clat_adaptor_s 2 141 4.6e-7 PFAM
Pfam:Adap_comp_sub 157 422 2.5e-94 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000126885
AA Change: Y59C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000120435
Gene: ENSMUSG00000003033
AA Change: Y59C

DomainStartEndE-ValueType
Pfam:Clat_adaptor_s 4 115 4.8e-7 PFAM
Pfam:Adap_comp_sub 131 181 6.4e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000145213
AA Change: Y59C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000138319
Gene: ENSMUSG00000003033
AA Change: Y59C

DomainStartEndE-ValueType
Pfam:Clat_adaptor_s 3 107 7e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151546
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156735
Predicted Effect probably benign
Transcript: ENSMUST00000212708
Predicted Effect probably damaging
Transcript: ENSMUST00000212841
AA Change: Y93C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000212940
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.2%
  • 20x: 90.9%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes the mu-1 subunit of the scaffolding adapter protein complex AP-1 and is a member of the mu adaptin family. The AP-1 complex, which consists of 4 subunits (mu-adaptin, beta-prime adaptin, gamma-adaptin, and the small chain adaptin), is one of the predominant coat proteins of membrane vesicles involved in eukaryotic post-Golgi trafficking. The AP-1 complex is located at the Golgi vesicle and links clathrin to receptors in coated vesicles. These vesicles are involved in endocytosis and Golgi processing. AP-1 complex subunit mu-1 and other mu-adaptins select cargo proteins bearing sequence-specific sorting motifs. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygous mutation of this gene results in embryonic lethality around E13.5. Homozygous embryos display hemorrhage of the ventricles and spinal canal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A4galt T C 15: 83,228,111 E157G probably benign Het
Abcb11 T C 2: 69,243,467 K1238R probably benign Het
Ankar T A 1: 72,698,887 E45D probably damaging Het
Antxrl G T 14: 34,075,635 K522N possibly damaging Het
As3mt C T 19: 46,708,128 T35M possibly damaging Het
Aspg T C 12: 112,113,042 S85P probably damaging Het
BC030499 T G 11: 78,293,020 probably null Het
Cachd1 T C 4: 100,952,019 S234P possibly damaging Het
Ccdc3 T C 2: 5,141,407 probably null Het
Cnpy1 T C 5: 28,245,761 T16A probably benign Het
Cope T C 8: 70,304,635 L43P probably benign Het
E2f8 T C 7: 48,870,777 M599V probably benign Het
Eif3a A T 19: 60,766,881 D954E unknown Het
Gfpt1 T A 6: 87,088,248 probably null Het
Ggps1 T G 13: 14,054,002 S145R probably benign Het
Gon4l A G 3: 88,896,093 D1337G probably damaging Het
Gtf2a1l G T 17: 88,694,103 G82V probably damaging Het
Gucy1b1 C A 3: 82,058,277 L87F probably damaging Het
Hoxc9 T C 15: 102,981,879 V76A probably benign Het
Ints2 T C 11: 86,238,468 E460G probably damaging Het
Kdm4b C T 17: 56,396,916 R756W probably damaging Het
Lax1 T A 1: 133,684,096 I34F probably benign Het
Marveld3 A T 8: 109,954,328 C312S probably damaging Het
Ncoa2 T C 1: 13,167,030 D824G possibly damaging Het
Nrxn2 C A 19: 6,498,328 A17D possibly damaging Het
Nup133 A T 8: 123,938,292 I220N probably damaging Het
Nup205 T C 6: 35,212,816 V984A probably benign Het
Nup54 A T 5: 92,422,994 D318E probably damaging Het
Obp2a A T 2: 25,701,139 K94N probably damaging Het
Olfr1469 T C 19: 13,411,039 S157P probably benign Het
Olfr318 A T 11: 58,720,370 I226N probably benign Het
Pappa2 T C 1: 158,936,250 I564V probably benign Het
Parpbp A G 10: 88,133,158 V142A possibly damaging Het
Rdh16f2 A T 10: 127,876,332 R219S probably benign Het
Rfx6 C T 10: 51,708,587 R228C probably damaging Het
Rpap2 A G 5: 107,601,901 probably null Het
Slc15a2 T C 16: 36,754,548 I531V probably benign Het
Srebf1 T C 11: 60,207,104 E58G possibly damaging Het
Tmem214 C A 5: 30,870,724 T96K possibly damaging Het
Usp19 T C 9: 108,496,380 Y691H probably damaging Het
Vmn1r86 C T 7: 13,102,198 W200* probably null Het
Vmn2r8 A T 5: 108,797,382 S786R probably damaging Het
Vps52 T A 17: 33,956,094 M1K probably null Het
Zzef1 T A 11: 72,824,065 probably null Het
Other mutations in Ap1m1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00792:Ap1m1 APN 8 72255755 missense possibly damaging 0.53
IGL00795:Ap1m1 APN 8 72253509 missense probably damaging 1.00
IGL02165:Ap1m1 APN 8 72249809 missense probably benign 0.41
R0363:Ap1m1 UTSW 8 72252894 missense probably benign 0.22
R0363:Ap1m1 UTSW 8 72256724 unclassified probably benign
R1295:Ap1m1 UTSW 8 72251875 splice site probably null
R1681:Ap1m1 UTSW 8 72256122 missense possibly damaging 0.95
R1784:Ap1m1 UTSW 8 72252849 missense probably benign 0.01
R1934:Ap1m1 UTSW 8 72255793 missense probably damaging 1.00
R4549:Ap1m1 UTSW 8 72240220 missense probably damaging 1.00
R4654:Ap1m1 UTSW 8 72252873 missense possibly damaging 0.94
R7048:Ap1m1 UTSW 8 72249798 missense probably damaging 1.00
R8253:Ap1m1 UTSW 8 72252886 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTAATCTTGGGCCCAGTG -3'
(R):5'- GTGGGAAAGACCAGCTCTAG -3'

Sequencing Primer
(F):5'- AATCTTGGGCCCAGTGTACCAC -3'
(R):5'- GCTCTAGGGAAAAATGTGCCCC -3'
Posted On2017-06-26