Mutagenetix > Incidental Mutation

Incidental Mutation 'R6003:Ints2'

478473

Institutional Source

Beutler Lab

Gene Symbol

Ints2

Ensembl Gene

ENSMUSG00000018068

Gene Name

integrator complex subunit 2

Synonyms

2810417D08Rik

MMRRC Submission

043252-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6003 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

86210681-86257575 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 86238468 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 460 (E460G)

Ref Sequence

ENSEMBL: ENSMUSP00000103674 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000018212] [ENSMUST00000108039]

AlphaFold

Q80UK8

Predicted Effect

probably damaging
Transcript: ENSMUST00000018212
AA Change: E460G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000018212
Gene: ENSMUSG00000018068
AA Change: E460G

Domain	Start	End	E-Value	Type
Pfam:INTS2	24	1131	N/A	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000108039
AA Change: E460G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000103674
Gene: ENSMUSG00000018068
AA Change: E460G

Domain	Start	End	E-Value	Type
Pfam:INTS2	24	1132	N/A	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127745

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134883

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143819

Coding Region Coverage

1x: 99.9%
3x: 99.4%
10x: 97.2%
20x: 90.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] INTS2 is a subunit of the Integrator complex, which associates with the C-terminal domain of RNA polymerase II large subunit (POLR2A; MIM 180660) and mediates 3-prime end processing of small nuclear RNAs U1 (RNU1; MIM 180680) and U2 (RNU2; MIM 180690) (Baillat et al., 2005 [PubMed 16239144]).[supplied by OMIM, Mar 2008]

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A4galt	T	C	15: 83,228,111	E157G	probably benign	Het
Abcb11	T	C	2: 69,243,467	K1238R	probably benign	Het
Ankar	T	A	1: 72,698,887	E45D	probably damaging	Het
Antxrl	G	T	14: 34,075,635	K522N	possibly damaging	Het
Ap1m1	A	G	8: 72,249,167	Y93C	probably damaging	Het
As3mt	C	T	19: 46,708,128	T35M	possibly damaging	Het
Aspg	T	C	12: 112,113,042	S85P	probably damaging	Het
BC030499	T	G	11: 78,293,020		probably null	Het
Cachd1	T	C	4: 100,952,019	S234P	possibly damaging	Het
Ccdc3	T	C	2: 5,141,407		probably null	Het
Cnpy1	T	C	5: 28,245,761	T16A	probably benign	Het
Cope	T	C	8: 70,304,635	L43P	probably benign	Het
E2f8	T	C	7: 48,870,777	M599V	probably benign	Het
Eif3a	A	T	19: 60,766,881	D954E	unknown	Het
Gfpt1	T	A	6: 87,088,248		probably null	Het
Ggps1	T	G	13: 14,054,002	S145R	probably benign	Het
Gon4l	A	G	3: 88,896,093	D1337G	probably damaging	Het
Gtf2a1l	G	T	17: 88,694,103	G82V	probably damaging	Het
Gucy1b1	C	A	3: 82,058,277	L87F	probably damaging	Het
Hoxc9	T	C	15: 102,981,879	V76A	probably benign	Het
Kdm4b	C	T	17: 56,396,916	R756W	probably damaging	Het
Lax1	T	A	1: 133,684,096	I34F	probably benign	Het
Marveld3	A	T	8: 109,954,328	C312S	probably damaging	Het
Ncoa2	T	C	1: 13,167,030	D824G	possibly damaging	Het
Nrxn2	C	A	19: 6,498,328	A17D	possibly damaging	Het
Nup133	A	T	8: 123,938,292	I220N	probably damaging	Het
Nup205	T	C	6: 35,212,816	V984A	probably benign	Het
Nup54	A	T	5: 92,422,994	D318E	probably damaging	Het
Obp2a	A	T	2: 25,701,139	K94N	probably damaging	Het
Olfr1469	T	C	19: 13,411,039	S157P	probably benign	Het
Olfr318	A	T	11: 58,720,370	I226N	probably benign	Het
Pappa2	T	C	1: 158,936,250	I564V	probably benign	Het
Parpbp	A	G	10: 88,133,158	V142A	possibly damaging	Het
Rdh16f2	A	T	10: 127,876,332	R219S	probably benign	Het
Rfx6	C	T	10: 51,708,587	R228C	probably damaging	Het
Rpap2	A	G	5: 107,601,901		probably null	Het
Slc15a2	T	C	16: 36,754,548	I531V	probably benign	Het
Srebf1	T	C	11: 60,207,104	E58G	possibly damaging	Het
Tmem214	C	A	5: 30,870,724	T96K	possibly damaging	Het
Usp19	T	C	9: 108,496,380	Y691H	probably damaging	Het
Vmn1r86	C	T	7: 13,102,198	W200*	probably null	Het
Vmn2r8	A	T	5: 108,797,382	S786R	probably damaging	Het
Vps52	T	A	17: 33,956,094	M1K	probably null	Het
Zzef1	T	A	11: 72,824,065		probably null	Het

Other mutations in Ints2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00807:Ints2	APN	11	86233135	missense	probably damaging	1.00
IGL02490:Ints2	APN	11	86233183	missense	possibly damaging	0.93
IGL02612:Ints2	APN	11	86215578	missense	probably damaging	1.00
IGL03396:Ints2	APN	11	86213062	missense	probably damaging	0.99
R0015:Ints2	UTSW	11	86249287	missense	probably damaging	1.00
R0015:Ints2	UTSW	11	86249287	missense	probably damaging	1.00
R0355:Ints2	UTSW	11	86234749	missense	probably benign	0.00
R0389:Ints2	UTSW	11	86248851	missense	probably damaging	1.00
R0631:Ints2	UTSW	11	86233196	missense	probably benign	0.02
R0944:Ints2	UTSW	11	86244463	missense	possibly damaging	0.85
R1268:Ints2	UTSW	11	86233085	missense	probably damaging	1.00
R1269:Ints2	UTSW	11	86233085	missense	probably damaging	1.00
R1270:Ints2	UTSW	11	86233085	missense	probably damaging	1.00
R1396:Ints2	UTSW	11	86249248	missense	probably damaging	0.98
R1474:Ints2	UTSW	11	86226781	missense	probably damaging	0.97
R1503:Ints2	UTSW	11	86226781	missense	probably damaging	0.97
R1840:Ints2	UTSW	11	86233085	missense	probably damaging	1.00
R1987:Ints2	UTSW	11	86217800	missense	probably benign	0.03
R1990:Ints2	UTSW	11	86248934	missense	possibly damaging	0.58
R1991:Ints2	UTSW	11	86248934	missense	possibly damaging	0.58
R3694:Ints2	UTSW	11	86243001	missense	probably benign	0.41
R4056:Ints2	UTSW	11	86242952	missense	probably damaging	1.00
R4057:Ints2	UTSW	11	86242952	missense	probably damaging	1.00
R4569:Ints2	UTSW	11	86256198	missense	probably damaging	1.00
R4585:Ints2	UTSW	11	86249275	missense	probably damaging	1.00
R4586:Ints2	UTSW	11	86249275	missense	probably damaging	1.00
R4806:Ints2	UTSW	11	86256209	missense	probably benign	0.10
R4929:Ints2	UTSW	11	86212653	missense	possibly damaging	0.56
R5031:Ints2	UTSW	11	86256200	missense	probably damaging	1.00
R5064:Ints2	UTSW	11	86249274	missense	probably damaging	1.00
R5270:Ints2	UTSW	11	86215795	missense	probably damaging	1.00
R5621:Ints2	UTSW	11	86242947	missense	probably benign	0.32
R5875:Ints2	UTSW	11	86238312	missense	probably benign	0.04
R5908:Ints2	UTSW	11	86215545	critical splice donor site	probably null
R5914:Ints2	UTSW	11	86222174	missense	probably benign	0.03
R5941:Ints2	UTSW	11	86250972	missense	probably benign	0.01
R5975:Ints2	UTSW	11	86226748	missense	possibly damaging	0.72
R6091:Ints2	UTSW	11	86236603	missense	probably damaging	0.96
R6209:Ints2	UTSW	11	86225058	missense	probably damaging	1.00
R6567:Ints2	UTSW	11	86226661	missense	probably benign	0.42
R6764:Ints2	UTSW	11	86212779	missense	probably benign	0.00
R7033:Ints2	UTSW	11	86233085	missense	probably damaging	1.00
R7132:Ints2	UTSW	11	86217754	missense	probably benign	0.26
R7337:Ints2	UTSW	11	86217842	missense	probably benign	0.00
R7410:Ints2	UTSW	11	86233226	missense	probably benign	0.02
R7483:Ints2	UTSW	11	86215618	missense	probably damaging	1.00
R7503:Ints2	UTSW	11	86232055	missense	probably benign
R7804:Ints2	UTSW	11	86212663	missense	possibly damaging	0.92
R7845:Ints2	UTSW	11	86238263	missense	possibly damaging	0.93
R7875:Ints2	UTSW	11	86213062	missense	probably damaging	0.99
R7918:Ints2	UTSW	11	86222217	missense	probably damaging	1.00
R7922:Ints2	UTSW	11	86244627	missense	probably benign	0.29
R8058:Ints2	UTSW	11	86255353	missense	probably benign	0.05
R8134:Ints2	UTSW	11	86212660	missense	probably damaging	1.00
R8189:Ints2	UTSW	11	86215570	missense	probably damaging	1.00
R8295:Ints2	UTSW	11	86225088	missense	probably damaging	0.97
R8348:Ints2	UTSW	11	86255423	missense	probably benign
R8448:Ints2	UTSW	11	86255423	missense	probably benign
R8784:Ints2	UTSW	11	86222137	missense	probably damaging	1.00
R8784:Ints2	UTSW	11	86225115	nonsense	probably null
R8942:Ints2	UTSW	11	86212894	missense	probably benign	0.00
R9037:Ints2	UTSW	11	86215704	missense	probably benign
R9154:Ints2	UTSW	11	86234698	missense	probably damaging	1.00
R9397:Ints2	UTSW	11	86244485	missense	probably benign	0.01
R9412:Ints2	UTSW	11	86226763	missense	probably damaging	0.99
R9472:Ints2	UTSW	11	86242998	missense
R9476:Ints2	UTSW	11	86244509	missense	probably benign
R9510:Ints2	UTSW	11	86244509	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- AGACTAAGTCAATGATAGCACTAAGCT -3'
(R):5'- AGTCTTTAAGAATGAGGAAAAGCTG -3'

Sequencing Primer
(F):5'- GCTGGTTGCTATGGAAATACATG -3'
(R):5'- CCATCGGTAATGAGATCTGATGCC -3'

Posted On

2017-06-26