Incidental Mutation 'R6003:Aspg'
ID478474
Institutional Source Beutler Lab
Gene Symbol Aspg
Ensembl Gene ENSMUSG00000037686
Gene Nameasparaginase
Synonyms
MMRRC Submission 043252-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.169) question?
Stock #R6003 (G1)
Quality Score184.009
Status Not validated
Chromosome12
Chromosomal Location112106679-112127559 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 112113042 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 85 (S85P)
Ref Sequence ENSEMBL: ENSMUSP00000078369 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079400] [ENSMUST00000223184]
Predicted Effect probably damaging
Transcript: ENSMUST00000079400
AA Change: S85P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000078369
Gene: ENSMUSG00000037686
AA Change: S85P

DomainStartEndE-ValueType
Asparaginase 10 348 2.67e-111 SMART
ANK 396 426 4.05e2 SMART
ANK 430 459 4.46e-7 SMART
ANK 463 494 1.1e2 SMART
ANK 530 559 4.73e2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175349
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199383
Predicted Effect probably benign
Transcript: ENSMUST00000220719
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221091
Predicted Effect unknown
Transcript: ENSMUST00000223184
AA Change: S35P
Predicted Effect unknown
Transcript: ENSMUST00000223412
AA Change: S92P
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223457
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.2%
  • 20x: 90.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A4galt T C 15: 83,228,111 E157G probably benign Het
Abcb11 T C 2: 69,243,467 K1238R probably benign Het
Ankar T A 1: 72,698,887 E45D probably damaging Het
Antxrl G T 14: 34,075,635 K522N possibly damaging Het
Ap1m1 A G 8: 72,249,167 Y93C probably damaging Het
As3mt C T 19: 46,708,128 T35M possibly damaging Het
BC030499 T G 11: 78,293,020 probably null Het
Cachd1 T C 4: 100,952,019 S234P possibly damaging Het
Ccdc3 T C 2: 5,141,407 probably null Het
Cnpy1 T C 5: 28,245,761 T16A probably benign Het
Cope T C 8: 70,304,635 L43P probably benign Het
E2f8 T C 7: 48,870,777 M599V probably benign Het
Eif3a A T 19: 60,766,881 D954E unknown Het
Gfpt1 T A 6: 87,088,248 probably null Het
Ggps1 T G 13: 14,054,002 S145R probably benign Het
Gon4l A G 3: 88,896,093 D1337G probably damaging Het
Gtf2a1l G T 17: 88,694,103 G82V probably damaging Het
Gucy1b1 C A 3: 82,058,277 L87F probably damaging Het
Hoxc9 T C 15: 102,981,879 V76A probably benign Het
Ints2 T C 11: 86,238,468 E460G probably damaging Het
Kdm4b C T 17: 56,396,916 R756W probably damaging Het
Lax1 T A 1: 133,684,096 I34F probably benign Het
Marveld3 A T 8: 109,954,328 C312S probably damaging Het
Ncoa2 T C 1: 13,167,030 D824G possibly damaging Het
Nrxn2 C A 19: 6,498,328 A17D possibly damaging Het
Nup133 A T 8: 123,938,292 I220N probably damaging Het
Nup205 T C 6: 35,212,816 V984A probably benign Het
Nup54 A T 5: 92,422,994 D318E probably damaging Het
Obp2a A T 2: 25,701,139 K94N probably damaging Het
Olfr1469 T C 19: 13,411,039 S157P probably benign Het
Olfr318 A T 11: 58,720,370 I226N probably benign Het
Pappa2 T C 1: 158,936,250 I564V probably benign Het
Parpbp A G 10: 88,133,158 V142A possibly damaging Het
Rdh16f2 A T 10: 127,876,332 R219S probably benign Het
Rfx6 C T 10: 51,708,587 R228C probably damaging Het
Rpap2 A G 5: 107,601,901 probably null Het
Slc15a2 T C 16: 36,754,548 I531V probably benign Het
Srebf1 T C 11: 60,207,104 E58G possibly damaging Het
Tmem214 C A 5: 30,870,724 T96K possibly damaging Het
Usp19 T C 9: 108,496,380 Y691H probably damaging Het
Vmn1r86 C T 7: 13,102,198 W200* probably null Het
Vmn2r8 A T 5: 108,797,382 S786R probably damaging Het
Vps52 T A 17: 33,956,094 M1K probably null Het
Zzef1 T A 11: 72,824,065 probably null Het
Other mutations in Aspg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01462:Aspg APN 12 112122953 missense probably benign
IGL02199:Aspg APN 12 112120992 missense probably benign 0.39
R0704:Aspg UTSW 12 112114472 missense probably damaging 1.00
R0730:Aspg UTSW 12 112112259 nonsense probably null
R1196:Aspg UTSW 12 112116524 missense possibly damaging 0.94
R1270:Aspg UTSW 12 112116447 missense probably damaging 1.00
R1466:Aspg UTSW 12 112121852 missense probably benign 0.20
R1466:Aspg UTSW 12 112121852 missense probably benign 0.20
R1592:Aspg UTSW 12 112119972 missense probably benign 0.17
R1826:Aspg UTSW 12 112123418 missense probably damaging 0.99
R1859:Aspg UTSW 12 112121172 missense possibly damaging 0.86
R2124:Aspg UTSW 12 112121174 missense probably benign 0.15
R2154:Aspg UTSW 12 112120974 missense probably benign 0.01
R2190:Aspg UTSW 12 112124888 missense probably damaging 0.96
R2221:Aspg UTSW 12 112114434 missense probably damaging 1.00
R2223:Aspg UTSW 12 112114434 missense probably damaging 1.00
R3907:Aspg UTSW 12 112112259 nonsense probably null
R4234:Aspg UTSW 12 112123316 nonsense probably null
R4258:Aspg UTSW 12 112121253 missense probably benign 0.00
R4270:Aspg UTSW 12 112121195 missense probably damaging 1.00
R4271:Aspg UTSW 12 112121195 missense probably damaging 1.00
R5386:Aspg UTSW 12 112123032 missense probably benign 0.01
R5431:Aspg UTSW 12 112123412 missense probably benign 0.13
R5458:Aspg UTSW 12 112120002 missense probably damaging 0.99
R5941:Aspg UTSW 12 112113085 missense probably benign 0.02
R6057:Aspg UTSW 12 112120998 missense probably damaging 0.96
R6928:Aspg UTSW 12 112126689 missense possibly damaging 0.52
R6979:Aspg UTSW 12 112120944 missense possibly damaging 0.77
R6998:Aspg UTSW 12 112112194 missense probably damaging 1.00
R7054:Aspg UTSW 12 112126390 missense probably damaging 0.98
R7060:Aspg UTSW 12 112122953 missense probably benign
R7124:Aspg UTSW 12 112122983 missense probably damaging 0.99
R7137:Aspg UTSW 12 112112198 missense possibly damaging 0.92
R7439:Aspg UTSW 12 112124821 missense possibly damaging 0.90
R7441:Aspg UTSW 12 112124821 missense possibly damaging 0.90
Z1176:Aspg UTSW 12 112113081 missense possibly damaging 0.58
Z1177:Aspg UTSW 12 112121021 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATGATGTGAGGCCAGTGAG -3'
(R):5'- ACTTGCCCAGTGTTCTGCAG -3'

Sequencing Primer
(F):5'- CCAGTGAGGGGGAATCTATTTAC -3'
(R):5'- AGTGTTCTGCAGGAGGCC -3'
Posted On2017-06-26