Incidental Mutation 'R6003:Hoxc9'
ID478478
Institutional Source Beutler Lab
Gene Symbol Hoxc9
Ensembl Gene ENSMUSG00000036139
Gene Namehomeobox C9
SynonymsHox-3.2
MMRRC Submission 043252-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6003 (G1)
Quality Score203.462
Status Not validated
Chromosome15
Chromosomal Location102976439-102985099 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 102981879 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 76 (V76A)
Ref Sequence ENSEMBL: ENSMUSP00000001706 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001706] [ENSMUST00000173306]
Predicted Effect probably benign
Transcript: ENSMUST00000001706
AA Change: V76A

PolyPhen 2 Score 0.149 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000001706
Gene: ENSMUSG00000036139
AA Change: V76A

DomainStartEndE-ValueType
Pfam:Hox9_act 1 179 2e-63 PFAM
HOX 192 254 8.84e-28 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173306
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174869
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.2%
  • 20x: 90.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the homeobox family of genes. The homeobox genes encode a highly conserved family of transcription factors that play an important role in morphogenesis in all multicellular organisms. Mammals possess four similar homeobox gene clusters, HOXA, HOXB, HOXC and HOXD, which are located on different chromosomes and consist of 9 to 11 genes arranged in tandem. This gene is one of several homeobox HOXC genes located in a cluster on chromosome 12. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene grow more slowly than normal and develop hunched backs. Forward transformations seen in vertebrae from L1 and forward to around T10. Abnormalities in the sternum and ribs attachments to the sternum are also seen. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A4galt T C 15: 83,228,111 E157G probably benign Het
Abcb11 T C 2: 69,243,467 K1238R probably benign Het
Ankar T A 1: 72,698,887 E45D probably damaging Het
Antxrl G T 14: 34,075,635 K522N possibly damaging Het
Ap1m1 A G 8: 72,249,167 Y93C probably damaging Het
As3mt C T 19: 46,708,128 T35M possibly damaging Het
Aspg T C 12: 112,113,042 S85P probably damaging Het
BC030499 T G 11: 78,293,020 probably null Het
Cachd1 T C 4: 100,952,019 S234P possibly damaging Het
Ccdc3 T C 2: 5,141,407 probably null Het
Cnpy1 T C 5: 28,245,761 T16A probably benign Het
Cope T C 8: 70,304,635 L43P probably benign Het
E2f8 T C 7: 48,870,777 M599V probably benign Het
Eif3a A T 19: 60,766,881 D954E unknown Het
Gfpt1 T A 6: 87,088,248 probably null Het
Ggps1 T G 13: 14,054,002 S145R probably benign Het
Gon4l A G 3: 88,896,093 D1337G probably damaging Het
Gtf2a1l G T 17: 88,694,103 G82V probably damaging Het
Gucy1b1 C A 3: 82,058,277 L87F probably damaging Het
Ints2 T C 11: 86,238,468 E460G probably damaging Het
Kdm4b C T 17: 56,396,916 R756W probably damaging Het
Lax1 T A 1: 133,684,096 I34F probably benign Het
Marveld3 A T 8: 109,954,328 C312S probably damaging Het
Ncoa2 T C 1: 13,167,030 D824G possibly damaging Het
Nrxn2 C A 19: 6,498,328 A17D possibly damaging Het
Nup133 A T 8: 123,938,292 I220N probably damaging Het
Nup205 T C 6: 35,212,816 V984A probably benign Het
Nup54 A T 5: 92,422,994 D318E probably damaging Het
Obp2a A T 2: 25,701,139 K94N probably damaging Het
Olfr1469 T C 19: 13,411,039 S157P probably benign Het
Olfr318 A T 11: 58,720,370 I226N probably benign Het
Pappa2 T C 1: 158,936,250 I564V probably benign Het
Parpbp A G 10: 88,133,158 V142A possibly damaging Het
Rdh16f2 A T 10: 127,876,332 R219S probably benign Het
Rfx6 C T 10: 51,708,587 R228C probably damaging Het
Rpap2 A G 5: 107,601,901 probably null Het
Slc15a2 T C 16: 36,754,548 I531V probably benign Het
Srebf1 T C 11: 60,207,104 E58G possibly damaging Het
Tmem214 C A 5: 30,870,724 T96K possibly damaging Het
Usp19 T C 9: 108,496,380 Y691H probably damaging Het
Vmn1r86 C T 7: 13,102,198 W200* probably null Het
Vmn2r8 A T 5: 108,797,382 S786R probably damaging Het
Vps52 T A 17: 33,956,094 M1K probably null Het
Zzef1 T A 11: 72,824,065 probably null Het
Other mutations in Hoxc9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01413:Hoxc9 APN 15 102984000 missense probably damaging 1.00
IGL01418:Hoxc9 APN 15 102984000 missense probably damaging 1.00
IGL03031:Hoxc9 APN 15 102984090 missense probably damaging 1.00
R0498:Hoxc9 UTSW 15 102983927 missense probably damaging 1.00
R1436:Hoxc9 UTSW 15 102981872 missense probably benign 0.03
R2059:Hoxc9 UTSW 15 102984123 missense probably benign 0.01
R2414:Hoxc9 UTSW 15 102984108 missense probably damaging 1.00
R2900:Hoxc9 UTSW 15 102981753 missense probably benign 0.00
R3807:Hoxc9 UTSW 15 102981684 missense possibly damaging 0.94
R3821:Hoxc9 UTSW 15 102982164 missense probably benign 0.32
R4824:Hoxc9 UTSW 15 102981793 nonsense probably null
R5165:Hoxc9 UTSW 15 102984000 missense probably damaging 1.00
R5700:Hoxc9 UTSW 15 102981881 missense possibly damaging 0.65
R5701:Hoxc9 UTSW 15 102981881 missense possibly damaging 0.65
R6145:Hoxc9 UTSW 15 102983959 missense probably damaging 1.00
R6570:Hoxc9 UTSW 15 102981753 missense probably benign 0.00
R7312:Hoxc9 UTSW 15 102982161 missense probably benign 0.02
R7434:Hoxc9 UTSW 15 102983982 missense probably damaging 1.00
R8080:Hoxc9 UTSW 15 102982119 missense probably benign 0.22
Predicted Primers PCR Primer
(F):5'- ACTATTACGTGGACTCGCTCATCTC -3'
(R):5'- ACATGTAGTCCGGGTAGCTG -3'

Sequencing Primer
(F):5'- TCGCTCATCTCTCACGACAATGAAG -3'
(R):5'- CTTGAGGGCGTAGTGACGG -3'
Posted On2017-06-26