Incidental Mutation 'R6003:Olfr1469'
ID478484
Institutional Source Beutler Lab
Gene Symbol Olfr1469
Ensembl Gene ENSMUSG00000063777
Gene Nameolfactory receptor 1469
SynonymsGA_x6K02T2RE5P-3743369-3744289, MOR202-11
MMRRC Submission 043252-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock #R6003 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location13407849-13414540 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 13411039 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 157 (S157P)
Ref Sequence ENSEMBL: ENSMUSP00000150006 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077538] [ENSMUST00000216910]
Predicted Effect probably benign
Transcript: ENSMUST00000077538
AA Change: S157P

PolyPhen 2 Score 0.335 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000076741
Gene: ENSMUSG00000063777
AA Change: S157P

DomainStartEndE-ValueType
Pfam:7tm_4 32 308 2e-47 PFAM
Pfam:7tm_1 42 290 2.3e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000216910
AA Change: S157P

PolyPhen 2 Score 0.335 (Sensitivity: 0.90; Specificity: 0.89)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.2%
  • 20x: 90.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A4galt T C 15: 83,228,111 E157G probably benign Het
Abcb11 T C 2: 69,243,467 K1238R probably benign Het
Ankar T A 1: 72,698,887 E45D probably damaging Het
Antxrl G T 14: 34,075,635 K522N possibly damaging Het
Ap1m1 A G 8: 72,249,167 Y93C probably damaging Het
As3mt C T 19: 46,708,128 T35M possibly damaging Het
Aspg T C 12: 112,113,042 S85P probably damaging Het
BC030499 T G 11: 78,293,020 probably null Het
Cachd1 T C 4: 100,952,019 S234P possibly damaging Het
Ccdc3 T C 2: 5,141,407 probably null Het
Cnpy1 T C 5: 28,245,761 T16A probably benign Het
Cope T C 8: 70,304,635 L43P probably benign Het
E2f8 T C 7: 48,870,777 M599V probably benign Het
Eif3a A T 19: 60,766,881 D954E unknown Het
Gfpt1 T A 6: 87,088,248 probably null Het
Ggps1 T G 13: 14,054,002 S145R probably benign Het
Gon4l A G 3: 88,896,093 D1337G probably damaging Het
Gtf2a1l G T 17: 88,694,103 G82V probably damaging Het
Gucy1b1 C A 3: 82,058,277 L87F probably damaging Het
Hoxc9 T C 15: 102,981,879 V76A probably benign Het
Ints2 T C 11: 86,238,468 E460G probably damaging Het
Kdm4b C T 17: 56,396,916 R756W probably damaging Het
Lax1 T A 1: 133,684,096 I34F probably benign Het
Marveld3 A T 8: 109,954,328 C312S probably damaging Het
Ncoa2 T C 1: 13,167,030 D824G possibly damaging Het
Nrxn2 C A 19: 6,498,328 A17D possibly damaging Het
Nup133 A T 8: 123,938,292 I220N probably damaging Het
Nup205 T C 6: 35,212,816 V984A probably benign Het
Nup54 A T 5: 92,422,994 D318E probably damaging Het
Obp2a A T 2: 25,701,139 K94N probably damaging Het
Olfr318 A T 11: 58,720,370 I226N probably benign Het
Pappa2 T C 1: 158,936,250 I564V probably benign Het
Parpbp A G 10: 88,133,158 V142A possibly damaging Het
Rdh16f2 A T 10: 127,876,332 R219S probably benign Het
Rfx6 C T 10: 51,708,587 R228C probably damaging Het
Rpap2 A G 5: 107,601,901 probably null Het
Slc15a2 T C 16: 36,754,548 I531V probably benign Het
Srebf1 T C 11: 60,207,104 E58G possibly damaging Het
Tmem214 C A 5: 30,870,724 T96K possibly damaging Het
Usp19 T C 9: 108,496,380 Y691H probably damaging Het
Vmn1r86 C T 7: 13,102,198 W200* probably null Het
Vmn2r8 A T 5: 108,797,382 S786R probably damaging Het
Vps52 T A 17: 33,956,094 M1K probably null Het
Zzef1 T A 11: 72,824,065 probably null Het
Other mutations in Olfr1469
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01064:Olfr1469 APN 19 13411226 missense probably benign 0.01
IGL01520:Olfr1469 APN 19 13410750 missense probably damaging 0.97
IGL01671:Olfr1469 APN 19 13410891 missense probably benign 0.29
IGL02247:Olfr1469 APN 19 13411467 missense probably benign 0.01
IGL02297:Olfr1469 APN 19 13411475 missense probably benign 0.00
IGL02417:Olfr1469 APN 19 13410895 missense possibly damaging 0.52
IGL02442:Olfr1469 APN 19 13410987 missense probably benign 0.00
IGL02989:Olfr1469 APN 19 13411486 missense probably benign
IGL03269:Olfr1469 APN 19 13411428 missense probably damaging 0.99
IGL02988:Olfr1469 UTSW 19 13411462 missense possibly damaging 0.75
R0707:Olfr1469 UTSW 19 13411420 missense probably benign 0.22
R1055:Olfr1469 UTSW 19 13411390 missense probably benign 0.10
R1102:Olfr1469 UTSW 19 13411090 missense probably damaging 1.00
R1946:Olfr1469 UTSW 19 13410779 missense possibly damaging 0.64
R2111:Olfr1469 UTSW 19 13410943 missense probably damaging 0.99
R4072:Olfr1469 UTSW 19 13410935 missense possibly damaging 0.49
R4073:Olfr1469 UTSW 19 13410935 missense possibly damaging 0.49
R4076:Olfr1469 UTSW 19 13410935 missense possibly damaging 0.49
R4726:Olfr1469 UTSW 19 13411105 missense probably damaging 1.00
R4939:Olfr1469 UTSW 19 13410855 missense probably benign 0.10
R5914:Olfr1469 UTSW 19 13410962 missense probably benign 0.31
R6743:Olfr1469 UTSW 19 13410593 missense probably damaging 1.00
R6825:Olfr1469 UTSW 19 13411150 missense probably benign 0.01
R6826:Olfr1469 UTSW 19 13411088 missense probably benign 0.05
R6970:Olfr1469 UTSW 19 13411428 missense probably damaging 0.99
R7558:Olfr1469 UTSW 19 13410991 missense probably damaging 1.00
R7596:Olfr1469 UTSW 19 13411147 missense probably benign 0.01
R7923:Olfr1469 UTSW 19 13410818 missense probably benign 0.17
R8014:Olfr1469 UTSW 19 13410811 missense not run
R8506:Olfr1469 UTSW 19 13411240 missense possibly damaging 0.49
R8746:Olfr1469 UTSW 19 13410728 missense probably benign 0.44
R8803:Olfr1469 UTSW 19 13410673 missense probably damaging 0.99
Z1177:Olfr1469 UTSW 19 13410719 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- AATGACTGTGCTGCTCAGATG -3'
(R):5'- TCCAGAACTTGAGTGCATTTTACAG -3'

Sequencing Primer
(F):5'- GTTATGCAGCAGTGTGCA -3'
(R):5'- TAGGATATCCAGATAACTGAGAGAGC -3'
Posted On2017-06-26