Incidental Mutation 'R6004:Inpp4a'
ID478488
Institutional Source Beutler Lab
Gene Symbol Inpp4a
Ensembl Gene ENSMUSG00000026113
Gene Nameinositol polyphosphate-4-phosphatase, type I
Synonyms107kDa
MMRRC Submission 044182-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.202) question?
Stock #R6004 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location37299865-37410736 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 37372370 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 372 (S372P)
Ref Sequence ENSEMBL: ENSMUSP00000121107 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027287] [ENSMUST00000058307] [ENSMUST00000114933] [ENSMUST00000132401] [ENSMUST00000132615] [ENSMUST00000136846] [ENSMUST00000137266] [ENSMUST00000140264] [ENSMUST00000168546] [ENSMUST00000193774]
Predicted Effect probably damaging
Transcript: ENSMUST00000027287
AA Change: S372P

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000027287
Gene: ENSMUSG00000026113
AA Change: S372P

DomainStartEndE-ValueType
Blast:C2 49 142 1e-57 BLAST
SCOP:d1bdya_ 50 168 7e-5 SMART
low complexity region 565 590 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000058307
AA Change: S107P

PolyPhen 2 Score 0.639 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000057233
Gene: ENSMUSG00000026113
AA Change: S107P

DomainStartEndE-ValueType
transmembrane domain 651 673 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000114933
AA Change: S107P

PolyPhen 2 Score 0.844 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000110583
Gene: ENSMUSG00000026113
AA Change: S107P

DomainStartEndE-ValueType
low complexity region 300 325 N/A INTRINSIC
transmembrane domain 662 684 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132401
AA Change: S372P

PolyPhen 2 Score 0.296 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000123071
Gene: ENSMUSG00000026113
AA Change: S372P

DomainStartEndE-ValueType
Blast:C2 49 142 1e-57 BLAST
SCOP:d1bdya_ 50 168 6e-5 SMART
low complexity region 602 623 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000132615
AA Change: S372P

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000115249
Gene: ENSMUSG00000026113
AA Change: S372P

DomainStartEndE-ValueType
Blast:C2 49 142 1e-57 BLAST
SCOP:d1bdya_ 50 168 7e-5 SMART
low complexity region 565 590 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000136846
AA Change: S372P

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000121518
Gene: ENSMUSG00000026113
AA Change: S372P

DomainStartEndE-ValueType
Blast:C2 49 142 9e-58 BLAST
SCOP:d1bdya_ 50 168 7e-5 SMART
low complexity region 559 584 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000137266
AA Change: S372P

PolyPhen 2 Score 0.259 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000121803
Gene: ENSMUSG00000026113
AA Change: S372P

DomainStartEndE-ValueType
Blast:C2 49 142 1e-57 BLAST
SCOP:d1bdya_ 50 168 6e-5 SMART
low complexity region 377 391 N/A INTRINSIC
low complexity region 607 628 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000140264
AA Change: S372P

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000121107
Gene: ENSMUSG00000026113
AA Change: S372P

DomainStartEndE-ValueType
Blast:C2 49 142 7e-58 BLAST
SCOP:d1bdya_ 50 168 7e-5 SMART
low complexity region 377 391 N/A INTRINSIC
low complexity region 564 589 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000168546
AA Change: S107P

PolyPhen 2 Score 0.660 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000130443
Gene: ENSMUSG00000026113
AA Change: S107P

DomainStartEndE-ValueType
transmembrane domain 651 673 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193774
SMART Domains Protein: ENSMUSP00000142118
Gene: ENSMUSG00000026113

DomainStartEndE-ValueType
Blast:C2 45 87 7e-13 BLAST
Meta Mutation Damage Score 0.0703 question?
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 96.8%
  • 20x: 89.1%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an Mg++ independent enzyme that hydrolyzes the 4-position phosphate from the inositol ring of phosphatidylinositol 3,4-bisphosphate, inositol 1,3,4-trisphosphate, and inositol 3,4-bisphosphate. Multiple transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Aug 2008]
PHENOTYPE: Homozygotes for a spontaneous mutation exhibit small size, ataxia, loss of cerebellar and hippocampal CA1 neurons, and death by 24 days of age from seizures and/or malnutrition. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acp6 C T 3: 97,175,681 A336V probably benign Het
Adam5 T A 8: 24,781,669 Y574F probably benign Het
Arl6 A T 16: 59,623,894 W80R probably damaging Het
Arntl A T 7: 113,280,727 D22V probably damaging Het
Cars2 A G 8: 11,547,743 I111T probably damaging Het
Chrd T C 16: 20,735,237 L317S possibly damaging Het
Cyp4a12b A G 4: 115,433,467 D262G probably benign Het
Dcaf6 A G 1: 165,388,685 S450P probably benign Het
Dnah3 T C 7: 120,086,297 D164G probably benign Het
Gpx6 A C 13: 21,319,069 T218P probably benign Het
Htr1f T C 16: 64,925,876 N351S probably damaging Het
Idua A G 5: 108,680,644 E241G probably benign Het
Ighv14-2 T A 12: 113,994,635 Q62L probably damaging Het
Ighv1-65 C T 12: 115,532,436 noncoding transcript Het
Itgax A T 7: 128,131,452 H114L probably damaging Het
Lama2 A T 10: 27,235,785 F746L probably benign Het
Lrrc37a C T 11: 103,502,536 V688M possibly damaging Het
Ltbp2 A G 12: 84,876,149 V28A probably benign Het
Mill2 A T 7: 18,856,538 D166V probably benign Het
Mroh2a G A 1: 88,248,655 C982Y probably damaging Het
Msh3 T A 13: 92,342,414 probably null Het
Myh15 A T 16: 49,159,699 M1395L probably benign Het
Npepps T C 11: 97,223,124 E642G probably benign Het
Nrg4 T C 9: 55,259,383 T68A possibly damaging Het
Olfr1016 A T 2: 85,799,382 V296E probably damaging Het
Olfr1130 T A 2: 87,607,909 F174I probably damaging Het
Olfr1313 G T 2: 112,072,026 L186I probably damaging Het
Olfr32 T C 2: 90,138,999 N47D probably benign Het
Olfr792 T A 10: 129,540,890 Y118N probably benign Het
Olfr890 A G 9: 38,143,960 K270R probably damaging Het
Otogl T A 10: 107,879,529 I429F probably damaging Het
Pank4 G T 4: 154,977,221 G532C probably damaging Het
Plce1 A G 19: 38,721,871 T1150A probably damaging Het
Ppp2r2b T C 18: 43,059,159 probably null Het
Prkrip1 A G 5: 136,197,782 M68T probably damaging Het
Psme4 T A 11: 30,856,896 probably benign Het
Raet1d T A 10: 22,371,394 I123N probably damaging Het
Rp1 T G 1: 4,197,585 T825P unknown Het
Rttn T C 18: 89,021,692 I839T probably damaging Het
Sgo2b G A 8: 63,926,673 Q1042* probably null Het
Skint11 A G 4: 114,231,728 T240A probably benign Het
Speg A T 1: 75,415,603 K1382* probably null Het
Srsf7 A T 17: 80,205,853 D68E probably damaging Het
Stag3 A T 5: 138,289,206 D131V probably damaging Het
Strip2 T A 6: 29,926,571 C152S probably damaging Het
Timm44 G T 8: 4,267,747 D191E probably benign Het
Tlnrd1 A G 7: 83,882,779 V148A probably damaging Het
Trp63 T C 16: 25,763,396 probably null Het
Tusc3 G C 8: 39,071,406 G200R probably damaging Het
Vmn2r10 T G 5: 108,999,078 N448T probably benign Het
Vmn2r50 G A 7: 10,050,059 R163C probably benign Het
Vmn2r53 T C 7: 12,582,401 H497R probably benign Het
Vps39 A G 2: 120,345,650 V83A possibly damaging Het
Ylpm1 A T 12: 85,029,084 N861I possibly damaging Het
Zfp712 A G 13: 67,041,705 C253R probably damaging Het
Zfp930 A G 8: 69,227,904 T84A probably benign Het
Other mutations in Inpp4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01348:Inpp4a APN 1 37388905 missense probably damaging 1.00
IGL01821:Inpp4a APN 1 37377717 missense probably damaging 1.00
IGL02015:Inpp4a APN 1 37389712 missense probably damaging 1.00
IGL02036:Inpp4a APN 1 37377569 intron probably benign
IGL02040:Inpp4a APN 1 37396085 missense probably damaging 0.99
IGL02082:Inpp4a APN 1 37366627 intron probably benign
IGL02318:Inpp4a APN 1 37368303 missense probably damaging 1.00
IGL02555:Inpp4a APN 1 37379968 missense possibly damaging 0.70
IGL02622:Inpp4a APN 1 37379034 missense probably benign 0.26
R0265:Inpp4a UTSW 1 37378986 missense probably damaging 1.00
R0388:Inpp4a UTSW 1 37396160 missense probably damaging 0.96
R0543:Inpp4a UTSW 1 37369492 intron probably benign
R1269:Inpp4a UTSW 1 37389742 missense probably benign 0.01
R1719:Inpp4a UTSW 1 37398799 missense probably damaging 1.00
R1799:Inpp4a UTSW 1 37392978 missense possibly damaging 0.56
R2127:Inpp4a UTSW 1 37366919 missense probably benign 0.08
R2143:Inpp4a UTSW 1 37387746 missense probably damaging 1.00
R2174:Inpp4a UTSW 1 37396130 missense probably damaging 1.00
R2258:Inpp4a UTSW 1 37377696 missense probably damaging 1.00
R2327:Inpp4a UTSW 1 37366166 missense probably damaging 0.96
R2437:Inpp4a UTSW 1 37392956 missense probably damaging 1.00
R2897:Inpp4a UTSW 1 37366594 missense probably benign 0.07
R2898:Inpp4a UTSW 1 37366594 missense probably benign 0.07
R4830:Inpp4a UTSW 1 37371780 missense probably damaging 1.00
R4934:Inpp4a UTSW 1 37387841 missense possibly damaging 0.74
R5141:Inpp4a UTSW 1 37380087 missense probably benign 0.17
R5152:Inpp4a UTSW 1 37358535 missense possibly damaging 0.88
R5627:Inpp4a UTSW 1 37367773 missense probably damaging 0.96
R5789:Inpp4a UTSW 1 37372329 missense possibly damaging 0.75
R6107:Inpp4a UTSW 1 37377748 missense probably damaging 0.98
R6180:Inpp4a UTSW 1 37380102 missense probably benign
R6434:Inpp4a UTSW 1 37398838 missense probably damaging 1.00
R6571:Inpp4a UTSW 1 37387758 missense probably damaging 1.00
R6766:Inpp4a UTSW 1 37372341 missense probably damaging 1.00
R6992:Inpp4a UTSW 1 37389691 missense probably damaging 0.98
R7025:Inpp4a UTSW 1 37369423 missense probably benign 0.00
R7126:Inpp4a UTSW 1 37374272 missense probably benign 0.00
R7473:Inpp4a UTSW 1 37369453 missense probably benign 0.37
R7509:Inpp4a UTSW 1 37387830 missense probably damaging 0.99
RF006:Inpp4a UTSW 1 37388827 missense possibly damaging 0.76
Predicted Primers PCR Primer
(F):5'- GCCAGAGGCTGTTTACATGTGG -3'
(R):5'- AGACTAGACTAGTGGCCAGG -3'

Sequencing Primer
(F):5'- GGGCTATAGGTCCCACAATGCTATC -3'
(R):5'- CACAGAGCAGCACAGGGTC -3'
Posted On2017-06-26