Incidental Mutation 'R6004:Olfr1130'
ID478493
Institutional Source Beutler Lab
Gene Symbol Olfr1130
Ensembl Gene ENSMUSG00000059205
Gene Nameolfactory receptor 1130
SynonymsMOR264-4, GA_x6K02T2Q125-49112575-49113519
MMRRC Submission 044182-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.123) question?
Stock #R6004 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location87606212-87609852 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 87607909 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 174 (F174I)
Ref Sequence ENSEMBL: ENSMUSP00000150905 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079711] [ENSMUST00000213103] [ENSMUST00000216580]
Predicted Effect probably damaging
Transcript: ENSMUST00000079711
AA Change: F174I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000078649
Gene: ENSMUSG00000068814
AA Change: F174I

DomainStartEndE-ValueType
Pfam:7tm_4 37 314 3.4e-52 PFAM
Pfam:7tm_1 47 296 1.3e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213103
AA Change: F174I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000216580
AA Change: F174I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.2624 question?
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 96.8%
  • 20x: 89.1%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acp6 C T 3: 97,175,681 A336V probably benign Het
Adam5 T A 8: 24,781,669 Y574F probably benign Het
Arl6 A T 16: 59,623,894 W80R probably damaging Het
Arntl A T 7: 113,280,727 D22V probably damaging Het
Cars2 A G 8: 11,547,743 I111T probably damaging Het
Chrd T C 16: 20,735,237 L317S possibly damaging Het
Cyp4a12b A G 4: 115,433,467 D262G probably benign Het
Dcaf6 A G 1: 165,388,685 S450P probably benign Het
Dnah3 T C 7: 120,086,297 D164G probably benign Het
Gpx6 A C 13: 21,319,069 T218P probably benign Het
Htr1f T C 16: 64,925,876 N351S probably damaging Het
Idua A G 5: 108,680,644 E241G probably benign Het
Ighv14-2 T A 12: 113,994,635 Q62L probably damaging Het
Ighv1-65 C T 12: 115,532,436 noncoding transcript Het
Inpp4a T C 1: 37,372,370 S372P probably damaging Het
Itgax A T 7: 128,131,452 H114L probably damaging Het
Lama2 A T 10: 27,235,785 F746L probably benign Het
Lrrc37a C T 11: 103,502,536 V688M possibly damaging Het
Ltbp2 A G 12: 84,876,149 V28A probably benign Het
Mill2 A T 7: 18,856,538 D166V probably benign Het
Mroh2a G A 1: 88,248,655 C982Y probably damaging Het
Msh3 T A 13: 92,342,414 probably null Het
Myh15 A T 16: 49,159,699 M1395L probably benign Het
Npepps T C 11: 97,223,124 E642G probably benign Het
Nrg4 T C 9: 55,259,383 T68A possibly damaging Het
Olfr1016 A T 2: 85,799,382 V296E probably damaging Het
Olfr1313 G T 2: 112,072,026 L186I probably damaging Het
Olfr32 T C 2: 90,138,999 N47D probably benign Het
Olfr792 T A 10: 129,540,890 Y118N probably benign Het
Olfr890 A G 9: 38,143,960 K270R probably damaging Het
Otogl T A 10: 107,879,529 I429F probably damaging Het
Pank4 G T 4: 154,977,221 G532C probably damaging Het
Plce1 A G 19: 38,721,871 T1150A probably damaging Het
Ppp2r2b T C 18: 43,059,159 probably null Het
Prkrip1 A G 5: 136,197,782 M68T probably damaging Het
Psme4 T A 11: 30,856,896 probably benign Het
Raet1d T A 10: 22,371,394 I123N probably damaging Het
Rp1 T G 1: 4,197,585 T825P unknown Het
Rttn T C 18: 89,021,692 I839T probably damaging Het
Sgo2b G A 8: 63,926,673 Q1042* probably null Het
Skint11 A G 4: 114,231,728 T240A probably benign Het
Speg A T 1: 75,415,603 K1382* probably null Het
Srsf7 A T 17: 80,205,853 D68E probably damaging Het
Stag3 A T 5: 138,289,206 D131V probably damaging Het
Strip2 T A 6: 29,926,571 C152S probably damaging Het
Timm44 G T 8: 4,267,747 D191E probably benign Het
Tlnrd1 A G 7: 83,882,779 V148A probably damaging Het
Trp63 T C 16: 25,763,396 probably null Het
Tusc3 G C 8: 39,071,406 G200R probably damaging Het
Vmn2r10 T G 5: 108,999,078 N448T probably benign Het
Vmn2r50 G A 7: 10,050,059 R163C probably benign Het
Vmn2r53 T C 7: 12,582,401 H497R probably benign Het
Vps39 A G 2: 120,345,650 V83A possibly damaging Het
Ylpm1 A T 12: 85,029,084 N861I possibly damaging Het
Zfp712 A G 13: 67,041,705 C253R probably damaging Het
Zfp930 A G 8: 69,227,904 T84A probably benign Het
Other mutations in Olfr1130
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01151:Olfr1130 APN 2 87607979 missense probably damaging 1.00
IGL01310:Olfr1130 APN 2 87607508 missense possibly damaging 0.68
IGL02558:Olfr1130 APN 2 87607559 missense probably benign 0.00
R0323:Olfr1130 UTSW 2 87607497 missense probably benign
R0590:Olfr1130 UTSW 2 87607994 missense probably damaging 0.98
R0718:Olfr1130 UTSW 2 87607927 missense probably benign 0.08
R2445:Olfr1130 UTSW 2 87607958 missense probably damaging 0.99
R3408:Olfr1130 UTSW 2 87607876 missense probably benign 0.03
R4280:Olfr1130 UTSW 2 87608251 missense possibly damaging 0.90
R4491:Olfr1130 UTSW 2 87607392 start codon destroyed probably null 0.84
R4928:Olfr1130 UTSW 2 87608143 missense probably benign 0.06
R5033:Olfr1130 UTSW 2 87607711 missense probably damaging 1.00
R5061:Olfr1130 UTSW 2 87607832 missense probably benign 0.00
R5109:Olfr1130 UTSW 2 87607411 missense possibly damaging 0.64
R5109:Olfr1130 UTSW 2 87607975 missense possibly damaging 0.78
R5772:Olfr1130 UTSW 2 87608173 missense probably benign 0.12
R6005:Olfr1130 UTSW 2 87608080 missense probably damaging 0.97
R6411:Olfr1130 UTSW 2 87607973 missense probably damaging 1.00
R6964:Olfr1130 UTSW 2 87607613 missense probably damaging 1.00
R7085:Olfr1130 UTSW 2 87607406 missense probably benign 0.00
R7484:Olfr1130 UTSW 2 87607937 missense probably damaging 1.00
X0060:Olfr1130 UTSW 2 87608042 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- ACTGAGTGTTTCCTGCTGGC -3'
(R):5'- GAAGAACATGTTGAGAAGGCTTTTG -3'

Sequencing Primer
(F):5'- GCTGTGATGTCTTATGACCGC -3'
(R):5'- TGGCAACTTCAGAATGGTGGC -3'
Posted On2017-06-26